Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220908877:

Variant ID: vg1220908877 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 20908877
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 38. )

Flanking Sequence (100 bp) in Reference Genome:

AACACCAATCGGAAGTAAAGATCTCTAGTCCCGATTATTTCACCCGAGAATAAATATAGCTATCTTTAGTTCCGGATTCGCCATCCCGGTTTCATAACCA[G/A]
GACAACAAACGGTTGCCAACCGATGACAAAGATTAGTTGTGCAGCAGTGTCATGTACTCCCAGTAGGCCAGTACTAGGTTGCTATGGTAGGAATGTGAGG

Reverse complement sequence

CCTCACATTCCTACCATAGCAACCTAGTACTGGCCTACTGGGAGTACATGACACTGCTGCACAACTAATCTTTGTCATCGGTTGGCAACCGTTTGTTGTC[C/T]
TGGTTATGAAACCGGGATGGCGAATCCGGAACTAAAGATAGCTATATTTATTCTCGGGTGAAATAATCGGGACTAGAGATCTTTACTTCCGATTGGTGTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.80%	33.10%	0.15%	6.94%	NA
All Indica	2759	52.10%	47.60%	0.04%	0.22%	NA
All Japonica	1512	79.60%	2.10%	0.20%	18.12%	NA
Aus	269	18.60%	70.30%	0.37%	10.78%	NA
Indica I	595	94.60%	5.20%	0.00%	0.17%	NA
Indica II	465	29.20%	70.80%	0.00%	0.00%	NA
Indica III	913	38.10%	61.70%	0.00%	0.22%	NA
Indica Intermediate	786	49.70%	49.70%	0.13%	0.38%	NA
Temperate Japonica	767	80.70%	1.00%	0.39%	17.86%	NA
Tropical Japonica	504	81.30%	3.80%	0.00%	14.88%	NA
Japonica Intermediate	241	72.20%	2.10%	0.00%	25.73%	NA
VI/Aromatic	96	72.90%	10.40%	1.04%	15.62%	NA
Intermediate	90	71.10%	23.30%	1.11%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1220908877	G -> DEL	N	N	silent_mutation	Average:57.856; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N
vg1220908877	G -> A	LOC_Os12g34524-LOC_Os12g34540	intergenic_region ; MODIFIER	silent_mutation	Average:57.856; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1220908877	NA	3.37E-08	mr1193	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220908877	NA	1.10E-06	mr1193	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220908877	NA	4.75E-07	mr1272	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220908877	NA	6.18E-07	mr1291	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220908877	NA	6.36E-06	mr1502	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220908877	NA	1.52E-07	mr1577	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220908877	NA	4.42E-10	mr1587	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220908877	NA	2.31E-07	mr1587	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220908877	NA	6.62E-06	mr1668	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220908877	NA	2.56E-06	mr1749	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220908877	NA	1.68E-06	mr1749	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220908877	7.81E-06	3.64E-08	mr1803	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220908877	NA	2.46E-06	mr1815	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220908877	NA	1.88E-06	mr1895_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251