\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220906459:

Variant ID: vg1220906459 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 20906459
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.82, A: 0.16, others allele: 0.00, population size: 45. )

Flanking Sequence (100 bp) in Reference Genome:


CTTCTTGCTCGTAGTCGTCGCAGGCAAACGCCAGGTTATCAGTCTTCTTGATGCTACTAGGGTGCAAACTGAAGAAAGCGCTAAGGTAATTGCAGTTTCT[G/A]
TTTTTTCTCTTGAAATTCCTTGCAGATTAGCACAAATTCCCCTTTTTTTTTTCCCCCAGATTGTTCAGGTTCTGTATACTAAGCAAATCTTTTCGTTAGC

Reverse complement sequence

GCTAACGAAAAGATTTGCTTAGTATACAGAACCTGAACAATCTGGGGGAAAAAAAAAAGGGGAATTTGTGCTAATCTGCAAGGAATTTCAAGAGAAAAAA[C/T]
AGAAACTGCAATTACCTTAGCGCTTTCTTCAGTTTGCACCCTAGTAGCATCAAGAAGACTGATAACCTGGCGTTTGCCTGCGACGACTACGAGCAAGAAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.50% 34.40% 0.44% 6.60% NA
All Indica  2759 51.10% 48.60% 0.11% 0.22% NA
All Japonica  1512 79.80% 2.30% 0.79% 17.13% NA
Aus  269 7.80% 80.70% 1.12% 10.41% NA
Indica I  595 94.60% 5.20% 0.00% 0.17% NA
Indica II  465 29.20% 70.80% 0.00% 0.00% NA
Indica III  913 35.70% 63.90% 0.22% 0.22% NA
Indica Intermediate  786 49.00% 50.50% 0.13% 0.38% NA
Temperate Japonica  767 80.40% 1.60% 0.52% 17.47% NA
Tropical Japonica  504 81.70% 3.80% 1.19% 13.29% NA
Japonica Intermediate  241 73.40% 1.70% 0.83% 24.07% NA
VI/Aromatic  96 69.80% 13.50% 1.04% 15.62% NA
Intermediate  90 68.90% 24.40% 2.22% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1220906459 G -> DEL N N silent_mutation Average:95.212; most accessible tissue: Callus, score: 97.646 N N N N
vg1220906459 G -> A LOC_Os12g34524-LOC_Os12g34540 intergenic_region ; MODIFIER silent_mutation Average:95.212; most accessible tissue: Callus, score: 97.646 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1220906459 G A -0.01 -0.01 -0.02 -0.01 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1220906459 NA 4.09E-08 mr1193 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220906459 NA 2.81E-06 mr1193 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220906459 NA 4.18E-07 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220906459 NA 3.44E-07 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220906459 NA 4.96E-06 mr1378 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220906459 NA 4.34E-07 mr1577 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220906459 2.35E-06 1.29E-11 mr1587 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220906459 8.30E-06 1.18E-07 mr1587 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220906459 NA 6.65E-06 mr1668 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220906459 NA 2.96E-06 mr1749 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220906459 NA 1.19E-06 mr1749 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220906459 NA 7.03E-06 mr1792 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220906459 1.99E-06 1.76E-09 mr1803 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220906459 NA 3.43E-06 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251