\
| Variant ID: vg1220880817 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 20880817 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 88. )
CATTCCAAACATTCACACTTAACATATACAAGATTGATCCTTGGATGGTGCAAAATCCCTCTTAAACTTATGCTCAATTAGCTAATTTTTCCTATATTCA[C/T]
GAAAAATATAGCTTTATGATCAAATCCATATGCGACAAATCCTAGAAGATGAGTGTGCTAAATACTATTTAGAGAAGATGGAGGACAGACACATAACAAA
TTTGTTATGTGTCTGTCCTCCATCTTCTCTAAATAGTATTTAGCACACTCATCTTCTAGGATTTGTCGCATATGGATTTGATCATAAAGCTATATTTTTC[G/A]
TGAATATAGGAAAAATTAGCTAATTGAGCATAAGTTTAAGAGGGATTTTGCACCATCCAAGGATCAATCTTGTATATGTTAAGTGTGAATGTTTGGAATG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.70% | 7.30% | 5.92% | 11.11% | NA |
| All Indica | 2759 | 70.80% | 0.70% | 9.71% | 18.88% | NA |
| All Japonica | 1512 | 81.00% | 18.70% | 0.26% | 0.00% | NA |
| Aus | 269 | 87.70% | 11.20% | 1.12% | 0.00% | NA |
| Indica I | 595 | 76.30% | 1.20% | 8.40% | 14.12% | NA |
| Indica II | 465 | 87.70% | 0.00% | 5.38% | 6.88% | NA |
| Indica III | 913 | 56.40% | 0.30% | 14.24% | 29.03% | NA |
| Indica Intermediate | 786 | 73.20% | 1.00% | 8.02% | 17.81% | NA |
| Temperate Japonica | 767 | 80.80% | 18.90% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 84.90% | 14.90% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 73.40% | 26.10% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 7.80% | 5.56% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1220880817 | C -> DEL | N | N | silent_mutation | Average:32.262; most accessible tissue: Callus, score: 66.719 | N | N | N | N |
| vg1220880817 | C -> T | LOC_Os12g34480.1 | upstream_gene_variant ; 3498.0bp to feature; MODIFIER | silent_mutation | Average:32.262; most accessible tissue: Callus, score: 66.719 | N | N | N | N |
| vg1220880817 | C -> T | LOC_Os12g34490.1 | upstream_gene_variant ; 784.0bp to feature; MODIFIER | silent_mutation | Average:32.262; most accessible tissue: Callus, score: 66.719 | N | N | N | N |
| vg1220880817 | C -> T | LOC_Os12g34500.1 | upstream_gene_variant ; 3905.0bp to feature; MODIFIER | silent_mutation | Average:32.262; most accessible tissue: Callus, score: 66.719 | N | N | N | N |
| vg1220880817 | C -> T | LOC_Os12g34490-LOC_Os12g34500 | intergenic_region ; MODIFIER | silent_mutation | Average:32.262; most accessible tissue: Callus, score: 66.719 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1220880817 | 8.49E-06 | 5.32E-08 | mr1057 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220880817 | NA | 9.72E-07 | mr1057 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220880817 | 1.10E-08 | NA | mr1334 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220880817 | NA | 2.20E-08 | mr1057_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220880817 | NA | 4.15E-07 | mr1057_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220880817 | 1.99E-10 | NA | mr1334_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220880817 | 3.97E-06 | NA | mr1530_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220880817 | 7.26E-06 | NA | mr1991_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |