Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1220880817:

Variant ID: vg1220880817 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 20880817
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:

CATTCCAAACATTCACACTTAACATATACAAGATTGATCCTTGGATGGTGCAAAATCCCTCTTAAACTTATGCTCAATTAGCTAATTTTTCCTATATTCA[C/T]
GAAAAATATAGCTTTATGATCAAATCCATATGCGACAAATCCTAGAAGATGAGTGTGCTAAATACTATTTAGAGAAGATGGAGGACAGACACATAACAAA

Reverse complement sequence

TTTGTTATGTGTCTGTCCTCCATCTTCTCTAAATAGTATTTAGCACACTCATCTTCTAGGATTTGTCGCATATGGATTTGATCATAAAGCTATATTTTTC[G/A]
TGAATATAGGAAAAATTAGCTAATTGAGCATAAGTTTAAGAGGGATTTTGCACCATCCAAGGATCAATCTTGTATATGTTAAGTGTGAATGTTTGGAATG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.70%	7.30%	5.92%	11.11%	NA
All Indica	2759	70.80%	0.70%	9.71%	18.88%	NA
All Japonica	1512	81.00%	18.70%	0.26%	0.00%	NA
Aus	269	87.70%	11.20%	1.12%	0.00%	NA
Indica I	595	76.30%	1.20%	8.40%	14.12%	NA
Indica II	465	87.70%	0.00%	5.38%	6.88%	NA
Indica III	913	56.40%	0.30%	14.24%	29.03%	NA
Indica Intermediate	786	73.20%	1.00%	8.02%	17.81%	NA
Temperate Japonica	767	80.80%	18.90%	0.26%	0.00%	NA
Tropical Japonica	504	84.90%	14.90%	0.20%	0.00%	NA
Japonica Intermediate	241	73.40%	26.10%	0.41%	0.00%	NA
VI/Aromatic	96	94.80%	5.20%	0.00%	0.00%	NA
Intermediate	90	82.20%	7.80%	5.56%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1220880817	C -> DEL	N	N	silent_mutation	Average:32.262; most accessible tissue: Callus, score: 66.719	N	N	N	N
vg1220880817	C -> T	LOC_Os12g34480.1	upstream_gene_variant ; 3498.0bp to feature; MODIFIER	silent_mutation	Average:32.262; most accessible tissue: Callus, score: 66.719	N	N	N	N
vg1220880817	C -> T	LOC_Os12g34490.1	upstream_gene_variant ; 784.0bp to feature; MODIFIER	silent_mutation	Average:32.262; most accessible tissue: Callus, score: 66.719	N	N	N	N
vg1220880817	C -> T	LOC_Os12g34500.1	upstream_gene_variant ; 3905.0bp to feature; MODIFIER	silent_mutation	Average:32.262; most accessible tissue: Callus, score: 66.719	N	N	N	N
vg1220880817	C -> T	LOC_Os12g34490-LOC_Os12g34500	intergenic_region ; MODIFIER	silent_mutation	Average:32.262; most accessible tissue: Callus, score: 66.719	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1220880817	8.49E-06	5.32E-08	mr1057	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220880817	NA	9.72E-07	mr1057	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220880817	1.10E-08	NA	mr1334	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220880817	NA	2.20E-08	mr1057_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220880817	NA	4.15E-07	mr1057_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220880817	1.99E-10	NA	mr1334_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220880817	3.97E-06	NA	mr1530_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220880817	7.26E-06	NA	mr1991_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251