\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220880817:

Variant ID: vg1220880817 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 20880817
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


CATTCCAAACATTCACACTTAACATATACAAGATTGATCCTTGGATGGTGCAAAATCCCTCTTAAACTTATGCTCAATTAGCTAATTTTTCCTATATTCA[C/T]
GAAAAATATAGCTTTATGATCAAATCCATATGCGACAAATCCTAGAAGATGAGTGTGCTAAATACTATTTAGAGAAGATGGAGGACAGACACATAACAAA

Reverse complement sequence

TTTGTTATGTGTCTGTCCTCCATCTTCTCTAAATAGTATTTAGCACACTCATCTTCTAGGATTTGTCGCATATGGATTTGATCATAAAGCTATATTTTTC[G/A]
TGAATATAGGAAAAATTAGCTAATTGAGCATAAGTTTAAGAGGGATTTTGCACCATCCAAGGATCAATCTTGTATATGTTAAGTGTGAATGTTTGGAATG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.70% 7.30% 5.92% 11.11% NA
All Indica  2759 70.80% 0.70% 9.71% 18.88% NA
All Japonica  1512 81.00% 18.70% 0.26% 0.00% NA
Aus  269 87.70% 11.20% 1.12% 0.00% NA
Indica I  595 76.30% 1.20% 8.40% 14.12% NA
Indica II  465 87.70% 0.00% 5.38% 6.88% NA
Indica III  913 56.40% 0.30% 14.24% 29.03% NA
Indica Intermediate  786 73.20% 1.00% 8.02% 17.81% NA
Temperate Japonica  767 80.80% 18.90% 0.26% 0.00% NA
Tropical Japonica  504 84.90% 14.90% 0.20% 0.00% NA
Japonica Intermediate  241 73.40% 26.10% 0.41% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 82.20% 7.80% 5.56% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1220880817 C -> DEL N N silent_mutation Average:32.262; most accessible tissue: Callus, score: 66.719 N N N N
vg1220880817 C -> T LOC_Os12g34480.1 upstream_gene_variant ; 3498.0bp to feature; MODIFIER silent_mutation Average:32.262; most accessible tissue: Callus, score: 66.719 N N N N
vg1220880817 C -> T LOC_Os12g34490.1 upstream_gene_variant ; 784.0bp to feature; MODIFIER silent_mutation Average:32.262; most accessible tissue: Callus, score: 66.719 N N N N
vg1220880817 C -> T LOC_Os12g34500.1 upstream_gene_variant ; 3905.0bp to feature; MODIFIER silent_mutation Average:32.262; most accessible tissue: Callus, score: 66.719 N N N N
vg1220880817 C -> T LOC_Os12g34490-LOC_Os12g34500 intergenic_region ; MODIFIER silent_mutation Average:32.262; most accessible tissue: Callus, score: 66.719 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1220880817 8.49E-06 5.32E-08 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220880817 NA 9.72E-07 mr1057 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220880817 1.10E-08 NA mr1334 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220880817 NA 2.20E-08 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220880817 NA 4.15E-07 mr1057_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220880817 1.99E-10 NA mr1334_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220880817 3.97E-06 NA mr1530_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220880817 7.26E-06 NA mr1991_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251