\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220875510:

Variant ID: vg1220875510 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 20875510
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGTGTGCTGGTGTGCCACACTACGGATTGCAGTTTGGCCGCAAAGCCACATGGCACATGACCATTCATTTATGCATCCACTAAAAAAGAAAGAAAAAAGT[C/A]
CTCATCTCCCCGATTTAATGTGGCGGAGAATCGATAAGCTTTGGTGCATCTCAGTCGTCCGTTCAATTCCATTTCAAATACACATCCCCACCTACGGTCG

Reverse complement sequence

CGACCGTAGGTGGGGATGTGTATTTGAAATGGAATTGAACGGACGACTGAGATGCACCAAAGCTTATCGATTCTCCGCCACATTAAATCGGGGAGATGAG[G/T]
ACTTTTTTCTTTCTTTTTTAGTGGATGCATAAATGAATGGTCATGTGCCATGTGGCTTTGCGGCCAAACTGCAATCCGTAGTGTGGCACACCAGCACACA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.60% 28.40% 0.00% 0.00% NA
All Indica  2759 93.90% 6.10% 0.00% 0.00% NA
All Japonica  1512 34.70% 65.30% 0.00% 0.00% NA
Aus  269 48.70% 51.30% 0.00% 0.00% NA
Indica I  595 86.40% 13.60% 0.00% 0.00% NA
Indica II  465 96.10% 3.90% 0.00% 0.00% NA
Indica III  913 98.40% 1.60% 0.00% 0.00% NA
Indica Intermediate  786 93.10% 6.90% 0.00% 0.00% NA
Temperate Japonica  767 7.60% 92.40% 0.00% 0.00% NA
Tropical Japonica  504 80.60% 19.40% 0.00% 0.00% NA
Japonica Intermediate  241 25.30% 74.70% 0.00% 0.00% NA
VI/Aromatic  96 89.60% 10.40% 0.00% 0.00% NA
Intermediate  90 58.90% 41.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1220875510 C -> A LOC_Os12g34460.2 downstream_gene_variant ; 4489.0bp to feature; MODIFIER silent_mutation Average:58.01; most accessible tissue: Callus, score: 82.752 N N N N
vg1220875510 C -> A LOC_Os12g34470.1 downstream_gene_variant ; 802.0bp to feature; MODIFIER silent_mutation Average:58.01; most accessible tissue: Callus, score: 82.752 N N N N
vg1220875510 C -> A LOC_Os12g34480.1 downstream_gene_variant ; 1342.0bp to feature; MODIFIER silent_mutation Average:58.01; most accessible tissue: Callus, score: 82.752 N N N N
vg1220875510 C -> A LOC_Os12g34490.1 downstream_gene_variant ; 4050.0bp to feature; MODIFIER silent_mutation Average:58.01; most accessible tissue: Callus, score: 82.752 N N N N
vg1220875510 C -> A LOC_Os12g34470-LOC_Os12g34480 intergenic_region ; MODIFIER silent_mutation Average:58.01; most accessible tissue: Callus, score: 82.752 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1220875510 NA 1.41E-06 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220875510 NA 7.47E-06 mr1034 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220875510 NA 1.71E-10 mr1093 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220875510 NA 2.50E-06 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220875510 NA 4.93E-10 mr1235 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220875510 NA 1.47E-09 mr1251 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220875510 2.83E-18 9.46E-90 mr1334 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220875510 NA 7.58E-07 mr1334 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220875510 2.38E-13 2.45E-29 mr1334 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220875510 NA 5.66E-07 mr1415 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220875510 NA 4.08E-11 mr1435 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220875510 NA 1.41E-06 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220875510 NA 7.31E-11 mr1539 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220875510 NA 3.00E-06 mr1555 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220875510 NA 5.66E-07 mr1567 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220875510 NA 2.28E-07 mr1599 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220875510 NA 1.37E-06 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220875510 NA 5.28E-06 mr1686 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220875510 NA 5.47E-08 mr1864 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220875510 4.48E-26 2.19E-111 mr1334_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220875510 1.62E-11 8.30E-16 mr1334_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220875510 6.84E-14 9.26E-36 mr1334_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220875510 NA 1.25E-07 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220875510 NA 4.82E-11 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220875510 5.22E-11 5.57E-55 mr1991_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220875510 3.02E-08 1.29E-14 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251