Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220867141:

Variant ID: vg1220867141 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 20867141
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:

CAGAAAAAATAGGCAGAAAACACGCGAGAAAAGCAAAACAAAAATGGGGAGAAAAATATGGCTTTCGTCATCAGTAAAAAAAAAGGAAAAGGAAAAACAT[G/A]
CTAGGAAAAACCTGTTAGAAAGAAATGCGCTATTTCTGAAAAATGGTTTGAGAAAATCGTGCAAGAAAAAACATCGTTTATAAAAAAAAAACGAGCCGCT

Reverse complement sequence

AGCGGCTCGTTTTTTTTTTATAAACGATGTTTTTTCTTGCACGATTTTCTCAAACCATTTTTCAGAAATAGCGCATTTCTTTCTAACAGGTTTTTCCTAG[C/T]
ATGTTTTTCCTTTTCCTTTTTTTTTACTGATGACGAAAGCCATATTTTTCTCCCCATTTTTGTTTTGCTTTTCTCGCGTGTTTTCTGCCTATTTTTTCTG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.70%	26.90%	9.10%	3.32%	NA
All Indica	2759	78.80%	6.10%	11.92%	3.23%	NA
All Japonica	1512	29.40%	65.50%	1.12%	4.03%	NA
Aus	269	49.10%	23.00%	26.77%	1.12%	NA
Indica I	595	57.10%	13.30%	22.86%	6.72%	NA
Indica II	465	82.40%	3.70%	10.97%	3.01%	NA
Indica III	913	89.90%	1.80%	6.79%	1.53%	NA
Indica Intermediate	786	80.00%	7.10%	10.18%	2.67%	NA
Temperate Japonica	767	6.80%	92.40%	0.39%	0.39%	NA
Tropical Japonica	504	67.70%	19.60%	2.78%	9.92%	NA
Japonica Intermediate	241	21.20%	75.50%	0.00%	3.32%	NA
VI/Aromatic	96	76.00%	18.80%	5.21%	0.00%	NA
Intermediate	90	50.00%	37.80%	7.78%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1220867141	G -> DEL	N	N	silent_mutation	Average:12.587; most accessible tissue: Minghui63 flower, score: 17.838	N	N	N	N
vg1220867141	G -> A	LOC_Os12g34450.1	upstream_gene_variant ; 660.0bp to feature; MODIFIER	silent_mutation	Average:12.587; most accessible tissue: Minghui63 flower, score: 17.838	N	N	N	N
vg1220867141	G -> A	LOC_Os12g34460.2	upstream_gene_variant ; 2276.0bp to feature; MODIFIER	silent_mutation	Average:12.587; most accessible tissue: Minghui63 flower, score: 17.838	N	N	N	N
vg1220867141	G -> A	LOC_Os12g34440.1	downstream_gene_variant ; 4139.0bp to feature; MODIFIER	silent_mutation	Average:12.587; most accessible tissue: Minghui63 flower, score: 17.838	N	N	N	N
vg1220867141	G -> A	LOC_Os12g34440-LOC_Os12g34450	intergenic_region ; MODIFIER	silent_mutation	Average:12.587; most accessible tissue: Minghui63 flower, score: 17.838	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1220867141	NA	1.65E-06	mr1013	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220867141	NA	7.23E-06	mr1034	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220867141	NA	4.61E-10	mr1093	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220867141	NA	1.77E-06	mr1121	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220867141	NA	1.88E-09	mr1251	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220867141	NA	1.12E-06	mr1252	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220867141	2.77E-16	4.17E-91	mr1334	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220867141	5.66E-13	8.25E-29	mr1334	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220867141	NA	9.48E-11	mr1435	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220867141	NA	2.72E-06	mr1471	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220867141	NA	2.73E-10	mr1539	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220867141	NA	5.00E-06	mr1555	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220867141	NA	3.60E-06	mr1642	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220867141	NA	5.43E-06	mr1686	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220867141	NA	4.35E-07	mr1733	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220867141	NA	8.30E-08	mr1864	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220867141	1.36E-28	6.41E-115	mr1334_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220867141	3.27E-11	4.65E-13	mr1334_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220867141	2.09E-13	6.98E-35	mr1334_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220867141	3.38E-06	NA	mr1750_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220867141	1.71E-12	1.31E-56	mr1991_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220867141	2.03E-08	8.61E-15	mr1991_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251