\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220867141:

Variant ID: vg1220867141 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 20867141
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


CAGAAAAAATAGGCAGAAAACACGCGAGAAAAGCAAAACAAAAATGGGGAGAAAAATATGGCTTTCGTCATCAGTAAAAAAAAAGGAAAAGGAAAAACAT[G/A]
CTAGGAAAAACCTGTTAGAAAGAAATGCGCTATTTCTGAAAAATGGTTTGAGAAAATCGTGCAAGAAAAAACATCGTTTATAAAAAAAAAACGAGCCGCT

Reverse complement sequence

AGCGGCTCGTTTTTTTTTTATAAACGATGTTTTTTCTTGCACGATTTTCTCAAACCATTTTTCAGAAATAGCGCATTTCTTTCTAACAGGTTTTTCCTAG[C/T]
ATGTTTTTCCTTTTCCTTTTTTTTTACTGATGACGAAAGCCATATTTTTCTCCCCATTTTTGTTTTGCTTTTCTCGCGTGTTTTCTGCCTATTTTTTCTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.70% 26.90% 9.10% 3.32% NA
All Indica  2759 78.80% 6.10% 11.92% 3.23% NA
All Japonica  1512 29.40% 65.50% 1.12% 4.03% NA
Aus  269 49.10% 23.00% 26.77% 1.12% NA
Indica I  595 57.10% 13.30% 22.86% 6.72% NA
Indica II  465 82.40% 3.70% 10.97% 3.01% NA
Indica III  913 89.90% 1.80% 6.79% 1.53% NA
Indica Intermediate  786 80.00% 7.10% 10.18% 2.67% NA
Temperate Japonica  767 6.80% 92.40% 0.39% 0.39% NA
Tropical Japonica  504 67.70% 19.60% 2.78% 9.92% NA
Japonica Intermediate  241 21.20% 75.50% 0.00% 3.32% NA
VI/Aromatic  96 76.00% 18.80% 5.21% 0.00% NA
Intermediate  90 50.00% 37.80% 7.78% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1220867141 G -> DEL N N silent_mutation Average:12.587; most accessible tissue: Minghui63 flower, score: 17.838 N N N N
vg1220867141 G -> A LOC_Os12g34450.1 upstream_gene_variant ; 660.0bp to feature; MODIFIER silent_mutation Average:12.587; most accessible tissue: Minghui63 flower, score: 17.838 N N N N
vg1220867141 G -> A LOC_Os12g34460.2 upstream_gene_variant ; 2276.0bp to feature; MODIFIER silent_mutation Average:12.587; most accessible tissue: Minghui63 flower, score: 17.838 N N N N
vg1220867141 G -> A LOC_Os12g34440.1 downstream_gene_variant ; 4139.0bp to feature; MODIFIER silent_mutation Average:12.587; most accessible tissue: Minghui63 flower, score: 17.838 N N N N
vg1220867141 G -> A LOC_Os12g34440-LOC_Os12g34450 intergenic_region ; MODIFIER silent_mutation Average:12.587; most accessible tissue: Minghui63 flower, score: 17.838 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1220867141 NA 1.65E-06 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220867141 NA 7.23E-06 mr1034 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220867141 NA 4.61E-10 mr1093 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220867141 NA 1.77E-06 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220867141 NA 1.88E-09 mr1251 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220867141 NA 1.12E-06 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220867141 2.77E-16 4.17E-91 mr1334 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220867141 5.66E-13 8.25E-29 mr1334 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220867141 NA 9.48E-11 mr1435 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220867141 NA 2.72E-06 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220867141 NA 2.73E-10 mr1539 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220867141 NA 5.00E-06 mr1555 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220867141 NA 3.60E-06 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220867141 NA 5.43E-06 mr1686 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220867141 NA 4.35E-07 mr1733 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220867141 NA 8.30E-08 mr1864 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220867141 1.36E-28 6.41E-115 mr1334_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220867141 3.27E-11 4.65E-13 mr1334_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220867141 2.09E-13 6.98E-35 mr1334_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220867141 3.38E-06 NA mr1750_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220867141 1.71E-12 1.31E-56 mr1991_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220867141 2.03E-08 8.61E-15 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251