Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220866478:

Variant ID: vg1220866478 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 20866478
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.73, A: 0.27, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

CTGATTCATGTAAAGGCAAAAAAAATTGAAAAAAACATCTAAAAAAGTTCGTCCGATTCCCTAAGAAAGTGGCAAAAAAATGGGTCGTAAAAAATAAAAA[A/G]
CTGGTTCGTATAAAATAAAAATTGCACGCGAGAAAAAATGGAAAGGGTGAAACAAAGTCCAATTTCTAATCAGTATAAATCTCTTCTCTATCTCTAGTCT

Reverse complement sequence

AGACTAGAGATAGAGAAGAGATTTATACTGATTAGAAATTGGACTTTGTTTCACCCTTTCCATTTTTTCTCGCGTGCAATTTTTATTTTATACGAACCAG[T/C]
TTTTTATTTTTTACGACCCATTTTTTTGCCACTTTCTTAGGGAATCGGACGAACTTTTTTAGATGTTTTTTTCAATTTTTTTTGCCTTTACATGAATCAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	26.80%	18.70%	51.97%	2.60%	NA
All Indica	2759	24.90%	5.40%	66.15%	3.55%	NA
All Japonica	1512	30.50%	46.00%	22.02%	1.46%	NA
Aus	269	18.20%	2.60%	79.18%	0.00%	NA
Indica I	595	30.40%	1.50%	63.03%	5.04%	NA
Indica II	465	22.60%	4.50%	64.95%	7.96%	NA
Indica III	913	24.60%	9.30%	65.50%	0.55%	NA
Indica Intermediate	786	22.50%	4.20%	69.97%	3.31%	NA
Temperate Japonica	767	21.00%	73.70%	4.82%	0.52%	NA
Tropical Japonica	504	43.80%	7.90%	45.24%	2.98%	NA
Japonica Intermediate	241	32.80%	37.80%	28.22%	1.24%	NA
VI/Aromatic	96	44.80%	5.20%	50.00%	0.00%	NA
Intermediate	90	26.70%	28.90%	41.11%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1220866478	A -> DEL	N	N	silent_mutation	Average:19.61; most accessible tissue: Callus, score: 36.97	N	N	N	N
vg1220866478	A -> G	LOC_Os12g34450.1	upstream_gene_variant ; 1323.0bp to feature; MODIFIER	silent_mutation	Average:19.61; most accessible tissue: Callus, score: 36.97	N	N	N	N
vg1220866478	A -> G	LOC_Os12g34460.2	upstream_gene_variant ; 2939.0bp to feature; MODIFIER	silent_mutation	Average:19.61; most accessible tissue: Callus, score: 36.97	N	N	N	N
vg1220866478	A -> G	LOC_Os12g34440.1	downstream_gene_variant ; 3476.0bp to feature; MODIFIER	silent_mutation	Average:19.61; most accessible tissue: Callus, score: 36.97	N	N	N	N
vg1220866478	A -> G	LOC_Os12g34440-LOC_Os12g34450	intergenic_region ; MODIFIER	silent_mutation	Average:19.61; most accessible tissue: Callus, score: 36.97	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1220866478	1.70E-07	NA	mr1334	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220866478	NA	7.78E-13	mr1790	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220866478	NA	5.33E-06	mr1039_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220866478	NA	2.70E-06	mr1057_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220866478	1.35E-08	NA	mr1334_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251