Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220865088:

Variant ID: vg1220865088 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 20865088
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.08, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:

TTTCATATTATAACACTTTCTAACATTTGCTCTCAATGTGAGTGTGTGTGCGCACGCCTAGATTTATTAACATTTATATAAATGTAGGTAATGCTAGAAA[G/A]
TCTTATAATCTGAAACGAAGGTACTTATTGCGTTCATTTTATGAACGTACTTAGCAGTACCTACGTTCACGATGGGAGTATGTGTACATGCAGTTGATCA

Reverse complement sequence

TGATCAACTGCATGTACACATACTCCCATCGTGAACGTAGGTACTGCTAAGTACGTTCATAAAATGAACGCAATAAGTACCTTCGTTTCAGATTATAAGA[C/T]
TTTCTAGCATTACCTACATTTATATAAATGTTAATAAATCTAGGCGTGCGCACACACACTCACATTGAGAGCAAATGTTAGAAAGTGTTATAATATGAAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.60%	26.20%	0.19%	0.00%	NA
All Indica	2759	94.70%	5.30%	0.04%	0.00%	NA
All Japonica	1512	34.50%	65.10%	0.40%	0.00%	NA
Aus	269	77.30%	22.30%	0.37%	0.00%	NA
Indica I	595	87.90%	12.10%	0.00%	0.00%	NA
Indica II	465	96.60%	3.40%	0.00%	0.00%	NA
Indica III	913	98.60%	1.40%	0.00%	0.00%	NA
Indica Intermediate	786	94.10%	5.70%	0.13%	0.00%	NA
Temperate Japonica	767	7.80%	91.90%	0.26%	0.00%	NA
Tropical Japonica	504	80.00%	19.60%	0.40%	0.00%	NA
Japonica Intermediate	241	24.10%	75.10%	0.83%	0.00%	NA
VI/Aromatic	96	82.30%	17.70%	0.00%	0.00%	NA
Intermediate	90	64.40%	34.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1220865088	G -> A	LOC_Os12g34450.1	upstream_gene_variant ; 2713.0bp to feature; MODIFIER	silent_mutation	Average:68.867; most accessible tissue: Zhenshan97 root, score: 80.68	N	N	N	N
vg1220865088	G -> A	LOC_Os12g34460.2	upstream_gene_variant ; 4329.0bp to feature; MODIFIER	silent_mutation	Average:68.867; most accessible tissue: Zhenshan97 root, score: 80.68	N	N	N	N
vg1220865088	G -> A	LOC_Os12g34440.1	downstream_gene_variant ; 2086.0bp to feature; MODIFIER	silent_mutation	Average:68.867; most accessible tissue: Zhenshan97 root, score: 80.68	N	N	N	N
vg1220865088	G -> A	LOC_Os12g34440-LOC_Os12g34450	intergenic_region ; MODIFIER	silent_mutation	Average:68.867; most accessible tissue: Zhenshan97 root, score: 80.68	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1220865088	NA	2.28E-06	mr1013	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220865088	NA	8.59E-10	mr1093	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220865088	1.59E-17	3.80E-99	mr1334	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220865088	5.49E-11	3.60E-27	mr1334	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220865088	3.28E-07	1.37E-08	mr1415	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220865088	NA	1.77E-10	mr1539	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220865088	3.28E-07	1.37E-08	mr1567	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220865088	NA	6.55E-06	mr1577	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220865088	NA	6.95E-06	mr1642	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220865088	NA	1.07E-09	mr1746	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220865088	NA	1.09E-07	mr1785	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220865088	1.96E-27	1.24E-123	mr1334_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220865088	1.42E-08	6.39E-12	mr1334_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220865088	1.30E-11	1.65E-33	mr1334_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220865088	1.15E-11	3.23E-59	mr1991_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220865088	3.45E-07	4.73E-14	mr1991_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251