\
| Variant ID: vg1220827723 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 20827723 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ATGTTGAGAAACATACAGTGGTCTTTCGGCTAGCTCCACAAGGTAATGGGCTAGACGATTTGAGTTCAAAGTCTAATCATTTTTAATTATTTGATATTAG[G/A]
TCATTCCCTAATATTCACATCTTTTTAGGGATATGATAATGTGTATTAGGGATTAGTAAGCATGCGAGAAGAAAAAACTAATTTTATATATATATATATA
TATATATATATATATAAAATTAGTTTTTTCTTCTCGCATGCTTACTAATCCCTAATACACATTATCATATCCCTAAAAAGATGTGAATATTAGGGAATGA[C/T]
CTAATATCAAATAATTAAAAATGATTAGACTTTGAACTCAAATCGTCTAGCCCATTACCTTGTGGAGCTAGCCGAAAGACCACTGTATGTTTCTCAACAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.00% | 7.40% | 0.32% | 1.31% | NA |
| All Indica | 2759 | 98.60% | 0.30% | 0.22% | 0.91% | NA |
| All Japonica | 1512 | 80.10% | 19.80% | 0.07% | 0.00% | NA |
| Aus | 269 | 72.90% | 11.50% | 2.97% | 12.64% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.00% | 0.00% | 0.43% | NA |
| Indica III | 913 | 98.00% | 0.30% | 0.44% | 1.20% | NA |
| Indica Intermediate | 786 | 97.80% | 0.40% | 0.25% | 1.53% | NA |
| Temperate Japonica | 767 | 81.00% | 19.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 81.90% | 18.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 73.40% | 26.10% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 3.10% | 0.00% | 3.12% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1220827723 | G -> DEL | N | N | silent_mutation | Average:50.702; most accessible tissue: Callus, score: 88.397 | N | N | N | N |
| vg1220827723 | G -> A | LOC_Os12g34360.1 | upstream_gene_variant ; 1251.0bp to feature; MODIFIER | silent_mutation | Average:50.702; most accessible tissue: Callus, score: 88.397 | N | N | N | N |
| vg1220827723 | G -> A | LOC_Os12g34350-LOC_Os12g34360 | intergenic_region ; MODIFIER | silent_mutation | Average:50.702; most accessible tissue: Callus, score: 88.397 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1220827723 | NA | 3.97E-07 | mr1057 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220827723 | NA | 6.93E-06 | mr1057 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220827723 | 4.48E-11 | NA | mr1334 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220827723 | NA | 4.04E-08 | mr1057_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220827723 | NA | 8.32E-07 | mr1057_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220827723 | 4.30E-12 | NA | mr1334_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220827723 | 7.73E-06 | NA | mr1991_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |