Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220795056:

Variant ID: vg1220795056 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 20795056
Reference Allele: G	Alternative Allele: T
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGGGGGCGTTTAGGACCGGCCTCAGGATGGGAACATCGGTGGTGGGCCGGCCACTATACCGCTAGATCTGGTGATAGTTGACCTTAGGACCGACAAATTT[G/T]
CCACCGAGGGCCTCGGTGGCGACGTCCTTGGCAAATGGATCAATGATGACGGTGCAGGGACGGTCGGCAGGGGAATCGGCTAGTAGTGAGTGACACAAGG

Reverse complement sequence

CCTTGTGTCACTCACTACTAGCCGATTCCCCTGCCGACCGTCCCTGCACCGTCATCATTGATCCATTTGCCAAGGACGTCGCCACCGAGGCCCTCGGTGG[C/A]
AAATTTGTCGGTCCTAAGGTCAACTATCACCAGATCTAGCGGTATAGTGGCCGGCCCACCACCGATGTTCCCATCCTGAGGCCGGTCCTAAACGCCCCCA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	77.20%	22.80%	0.04%	0.00%	NA
All Indica	2759	98.70%	1.30%	0.07%	0.00%	NA
All Japonica	1512	36.80%	63.20%	0.00%	0.00%	NA
Aus	269	83.60%	16.40%	0.00%	0.00%	NA
Indica I	595	98.50%	1.30%	0.17%	0.00%	NA
Indica II	465	96.80%	3.20%	0.00%	0.00%	NA
Indica III	913	99.50%	0.50%	0.00%	0.00%	NA
Indica Intermediate	786	99.00%	0.90%	0.13%	0.00%	NA
Temperate Japonica	767	8.00%	92.00%	0.00%	0.00%	NA
Tropical Japonica	504	79.60%	20.40%	0.00%	0.00%	NA
Japonica Intermediate	241	39.40%	60.60%	0.00%	0.00%	NA
VI/Aromatic	96	84.40%	15.60%	0.00%	0.00%	NA
Intermediate	90	68.90%	31.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1220795056	G -> T	LOC_Os12g34310.1	upstream_gene_variant ; 991.0bp to feature; MODIFIER	silent_mutation	Average:68.959; most accessible tissue: Zhenshan97 panicle, score: 86.788	N	N	N	N
vg1220795056	G -> T	LOC_Os12g34300.1	downstream_gene_variant ; 3051.0bp to feature; MODIFIER	silent_mutation	Average:68.959; most accessible tissue: Zhenshan97 panicle, score: 86.788	N	N	N	N
vg1220795056	G -> T	LOC_Os12g34300-LOC_Os12g34310	intergenic_region ; MODIFIER	silent_mutation	Average:68.959; most accessible tissue: Zhenshan97 panicle, score: 86.788	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1220795056	NA	3.57E-07	mr1013	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220795056	NA	1.55E-06	mr1034	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220795056	NA	8.39E-06	mr1087	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220795056	NA	7.14E-42	mr1089	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220795056	NA	2.74E-09	mr1089	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220795056	NA	2.99E-43	mr1093	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220795056	NA	4.52E-12	mr1093	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220795056	NA	1.14E-06	mr1121	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220795056	NA	9.53E-06	mr1125	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220795056	NA	5.52E-07	mr1129	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220795056	NA	7.57E-39	mr1235	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220795056	NA	8.40E-11	mr1235	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220795056	NA	4.02E-11	mr1251	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220795056	NA	1.62E-07	mr1252	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220795056	1.52E-46	1.02E-147	mr1334	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220795056	2.81E-24	1.20E-38	mr1334	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220795056	NA	1.98E-07	mr1403	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220795056	NA	1.12E-37	mr1435	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220795056	NA	1.55E-12	mr1435	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220795056	NA	1.37E-10	mr1539	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220795056	NA	3.63E-08	mr1599	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220795056	NA	6.96E-08	mr1671	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220795056	NA	1.63E-14	mr1771	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220795056	NA	4.29E-10	mr1790	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220795056	NA	2.22E-08	mr1864	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220795056	2.90E-49	1.76E-165	mr1334_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220795056	3.80E-20	1.35E-42	mr1334_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220795056	5.45E-19	1.14E-71	mr1991_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220795056	1.47E-13	3.43E-19	mr1991_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251