\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220793865:

Variant ID: vg1220793865 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 20793865
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.02, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


CATCTCAAGAACCTGACATCTTAATTTGGGGTTTGGAGAGAAACAAGAGATTTAATTCCCAATCCTTGTATAGAGCTTTGACTTTTAGAGGGATACGAGA[C/A]
ACTTGGACATGAGTTTATTTTGGGAGGCCTCCTGCCCAATGAAAATTAAACATTTTATTTGGCTAGGAAAAAGGGATAAGATTCAATCTGCTGAACAGCT

Reverse complement sequence

AGCTGTTCAGCAGATTGAATCTTATCCCTTTTTCCTAGCCAAATAAAATGTTTAATTTTCATTGGGCAGGAGGCCTCCCAAAATAAACTCATGTCCAAGT[G/T]
TCTCGTATCCCTCTAAAAGTCAAAGCTCTATACAAGGATTGGGAATTAAATCTCTTGTTTCTCTCCAAACCCCAAATTAAGATGTCAGGTTCTTGAGATG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.40% 23.00% 0.47% 33.20% NA
All Indica  2759 51.40% 1.80% 0.58% 46.18% NA
All Japonica  1512 34.80% 63.30% 0.13% 1.79% NA
Aus  269 1.10% 16.70% 0.00% 82.16% NA
Indica I  595 61.00% 1.20% 0.84% 36.97% NA
Indica II  465 42.60% 4.30% 0.86% 52.26% NA
Indica III  913 45.80% 1.20% 0.22% 52.79% NA
Indica Intermediate  786 55.90% 1.70% 0.64% 41.86% NA
Temperate Japonica  767 6.80% 92.20% 0.00% 1.04% NA
Tropical Japonica  504 75.60% 20.60% 0.40% 3.37% NA
Japonica Intermediate  241 38.60% 60.60% 0.00% 0.83% NA
VI/Aromatic  96 69.80% 4.20% 0.00% 26.04% NA
Intermediate  90 38.90% 32.20% 4.44% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1220793865 C -> DEL N N silent_mutation Average:35.105; most accessible tissue: Minghui63 young leaf, score: 49.581 N N N N
vg1220793865 C -> A LOC_Os12g34310.1 upstream_gene_variant ; 2182.0bp to feature; MODIFIER silent_mutation Average:35.105; most accessible tissue: Minghui63 young leaf, score: 49.581 N N N N
vg1220793865 C -> A LOC_Os12g34300.1 downstream_gene_variant ; 1860.0bp to feature; MODIFIER silent_mutation Average:35.105; most accessible tissue: Minghui63 young leaf, score: 49.581 N N N N
vg1220793865 C -> A LOC_Os12g34300-LOC_Os12g34310 intergenic_region ; MODIFIER silent_mutation Average:35.105; most accessible tissue: Minghui63 young leaf, score: 49.581 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1220793865 NA 4.48E-07 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220793865 NA 2.00E-06 mr1034 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220793865 NA 6.12E-11 mr1093 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220793865 NA 8.78E-06 mr1096 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220793865 NA 7.20E-06 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220793865 1.64E-11 NA mr1334 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220793865 7.57E-15 6.69E-31 mr1334 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220793865 NA 1.40E-07 mr1403 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220793865 NA 9.39E-11 mr1435 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220793865 NA 3.57E-10 mr1539 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220793865 NA 1.34E-07 mr1599 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220793865 NA 2.76E-06 mr1671 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220793865 NA 1.43E-09 mr1089_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220793865 NA 3.10E-07 mr1090_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220793865 NA 8.63E-10 mr1235_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220793865 NA 5.21E-06 mr1268_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220793865 2.44E-12 NA mr1334_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220793865 5.91E-16 2.12E-38 mr1334_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220793865 NA 1.84E-08 mr1862_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220793865 8.38E-06 NA mr1991_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220793865 2.48E-11 2.78E-17 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251