| Variant ID: vg1220793576 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 20793576 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, A: 0.01, others allele: 0.00, population size: 254. )
GCTATTTGAGAATGGATCTAGCTATTTGCTCTCATGGAGAACAATTTAACCGTTATAGTTGTCTGAGAAGACCAACCGCTAAATGTCTTAGCCTGCTATT[A/T]
AAAACACTAGATGGAACTGCCCTCTTAAGACCAAATTTCTCTTGCTCTTTCAGATTAATAACCAGCAAGAGATAATTATGGCTGAGGTGTTAACAAAAGG
CCTTTTGTTAACACCTCAGCCATAATTATCTCTTGCTGGTTATTAATCTGAAAGAGCAAGAGAAATTTGGTCTTAAGAGGGCAGTTCCATCTAGTGTTTT[T/A]
AATAGCAGGCTAAGACATTTAGCGGTTGGTCTTCTCAGACAACTATAACGGTTAAATTGTTCTCCATGAGAGCAAATAGCTAGATCCATTCTCAAATAGC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.20% | 21.80% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 36.80% | 63.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 94.10% | 5.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 7.80% | 92.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 79.80% | 20.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 39.40% | 60.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 72.20% | 27.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1220793576 | A -> T | LOC_Os12g34310.1 | upstream_gene_variant ; 2471.0bp to feature; MODIFIER | silent_mutation | Average:40.247; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg1220793576 | A -> T | LOC_Os12g34300.1 | downstream_gene_variant ; 1571.0bp to feature; MODIFIER | silent_mutation | Average:40.247; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg1220793576 | A -> T | LOC_Os12g34300-LOC_Os12g34310 | intergenic_region ; MODIFIER | silent_mutation | Average:40.247; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1220793576 | NA | 8.65E-07 | mr1013 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220793576 | NA | 3.58E-06 | mr1034 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220793576 | NA | 1.28E-43 | mr1093 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220793576 | NA | 4.20E-11 | mr1093 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220793576 | NA | 9.33E-16 | mr1156 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220793576 | NA | 9.84E-40 | mr1235 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220793576 | NA | 8.18E-07 | mr1252 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220793576 | NA | 9.62E-06 | mr1328 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220793576 | 1.11E-42 | 1.04E-153 | mr1334 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220793576 | 6.26E-15 | 2.64E-32 | mr1334 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/