Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220773854:

Variant ID: vg1220773854 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 20773854
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

GGGTTTCTCCACCAGTGTATGCACGGCTGCACAAACACGAAGAGCTGACATCTTGGGTTATTATGCATAGAGAGTTGGATCGACTTACTCAAAACTACAG[G/A]
GGAGGCCGCTCAGTCGGTCTAGGATTAGTGGGAAAGTCTGGCAAACACGGCAAGAGTCCCCAAGAAGGGACTGCGCACCCTCATCCTCCTTGTTGTGTGG

Reverse complement sequence

CCACACAACAAGGAGGATGAGGGTGCGCAGTCCCTTCTTGGGGACTCTTGCCGTGTTTGCCAGACTTTCCCACTAATCCTAGACCGACTGAGCGGCCTCC[C/T]
CTGTAGTTTTGAGTAAGTCGATCCAACTCTCTATGCATAATAACCCAAGATGTCAGCTCTTCGTGTTTGTGCAGCCGTGCATACACTGGTGGAGAAACCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.40%	17.60%	0.02%	0.00%	NA
All Indica	2759	90.00%	10.00%	0.00%	0.00%	NA
All Japonica	1512	69.20%	30.70%	0.07%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	65.40%	34.60%	0.00%	0.00%	NA
Indica II	465	98.50%	1.50%	0.00%	0.00%	NA
Indica III	913	97.70%	2.30%	0.00%	0.00%	NA
Indica Intermediate	786	94.70%	5.30%	0.00%	0.00%	NA
Temperate Japonica	767	94.30%	5.70%	0.00%	0.00%	NA
Tropical Japonica	504	26.40%	73.40%	0.20%	0.00%	NA
Japonica Intermediate	241	79.30%	20.70%	0.00%	0.00%	NA
VI/Aromatic	96	32.30%	67.70%	0.00%	0.00%	NA
Intermediate	90	72.20%	27.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1220773854	G -> A	LOC_Os12g34270.1	upstream_gene_variant ; 1236.0bp to feature; MODIFIER	silent_mutation	Average:48.79; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg1220773854	G -> A	LOC_Os12g34260.1	downstream_gene_variant ; 585.0bp to feature; MODIFIER	silent_mutation	Average:48.79; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg1220773854	G -> A	LOC_Os12g34260-LOC_Os12g34270	intergenic_region ; MODIFIER	silent_mutation	Average:48.79; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1220773854	NA	2.17E-06	mr1013	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220773854	NA	4.70E-06	mr1034	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220773854	NA	9.21E-06	mr1096	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220773854	NA	3.90E-08	mr1229	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220773854	NA	1.61E-06	mr1252	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220773854	3.56E-13	NA	mr1334	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220773854	7.92E-14	4.33E-29	mr1334	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220773854	NA	1.22E-07	mr1403	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220773854	NA	6.36E-07	mr1596	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220773854	NA	4.97E-07	mr1671	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220773854	NA	1.09E-06	mr1121_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220773854	NA	1.05E-06	mr1250_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220773854	6.02E-15	NA	mr1334_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220773854	4.63E-15	5.06E-36	mr1334_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220773854	NA	4.57E-06	mr1359_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220773854	NA	9.45E-08	mr1817_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220773854	2.01E-10	1.65E-16	mr1991_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251