\
| Variant ID: vg1220761649 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 20761649 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AGTGGCACGGTGCGGCGGCGAGGTGAAGAGGGGCAGCGGTGCGCGGCGGCAAGGCGGATGTGGAGGAGAGGAGGATGGCCCGACGCAGAAGTACACCCCT[C/T]
TCCCCCTTCTTCCCTCCTCCCCTTAGAAAAATTTGCTCATGTGTGTGATGGATTTTGTGAATGTGTGATGGATTTGTGCATGTATGTGATGGATTTGTCC
GGACAAATCCATCACATACATGCACAAATCCATCACACATTCACAAAATCCATCACACACATGAGCAAATTTTTCTAAGGGGAGGAGGGAAGAAGGGGGA[G/A]
AGGGGTGTACTTCTGCGTCGGGCCATCCTCCTCTCCTCCACATCCGCCTTGCCGCCGCGCACCGCTGCCCCTCTTCACCTCGCCGCCGCACCGTGCCACT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.90% | 1.70% | 1.74% | 56.71% | NA |
| All Indica | 2759 | 16.60% | 0.10% | 2.07% | 81.15% | NA |
| All Japonica | 1512 | 72.40% | 3.80% | 0.93% | 22.88% | NA |
| Aus | 269 | 78.10% | 0.00% | 0.74% | 21.19% | NA |
| Indica I | 595 | 6.10% | 0.00% | 3.36% | 90.59% | NA |
| Indica II | 465 | 28.00% | 0.00% | 1.51% | 70.54% | NA |
| Indica III | 913 | 14.80% | 0.10% | 0.88% | 84.23% | NA |
| Indica Intermediate | 786 | 20.10% | 0.40% | 2.80% | 76.72% | NA |
| Temperate Japonica | 767 | 94.00% | 0.10% | 0.13% | 5.74% | NA |
| Tropical Japonica | 504 | 39.50% | 9.90% | 2.38% | 48.21% | NA |
| Japonica Intermediate | 241 | 72.20% | 2.90% | 0.41% | 24.48% | NA |
| VI/Aromatic | 96 | 72.90% | 13.50% | 7.29% | 6.25% | NA |
| Intermediate | 90 | 56.70% | 5.60% | 2.22% | 35.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1220761649 | C -> DEL | N | N | silent_mutation | Average:7.168; most accessible tissue: Callus, score: 26.637 | N | N | N | N |
| vg1220761649 | C -> T | LOC_Os12g34240.1 | upstream_gene_variant ; 1058.0bp to feature; MODIFIER | silent_mutation | Average:7.168; most accessible tissue: Callus, score: 26.637 | N | N | N | N |
| vg1220761649 | C -> T | LOC_Os12g34250.1 | upstream_gene_variant ; 1662.0bp to feature; MODIFIER | silent_mutation | Average:7.168; most accessible tissue: Callus, score: 26.637 | N | N | N | N |
| vg1220761649 | C -> T | LOC_Os12g34240-LOC_Os12g34250 | intergenic_region ; MODIFIER | silent_mutation | Average:7.168; most accessible tissue: Callus, score: 26.637 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1220761649 | 1.62E-07 | NA | mr1301 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220761649 | 7.14E-07 | NA | mr1410 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220761649 | 1.91E-06 | NA | mr1301_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220761649 | 2.29E-07 | NA | mr1410_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |