\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220761649:

Variant ID: vg1220761649 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 20761649
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGTGGCACGGTGCGGCGGCGAGGTGAAGAGGGGCAGCGGTGCGCGGCGGCAAGGCGGATGTGGAGGAGAGGAGGATGGCCCGACGCAGAAGTACACCCCT[C/T]
TCCCCCTTCTTCCCTCCTCCCCTTAGAAAAATTTGCTCATGTGTGTGATGGATTTTGTGAATGTGTGATGGATTTGTGCATGTATGTGATGGATTTGTCC

Reverse complement sequence

GGACAAATCCATCACATACATGCACAAATCCATCACACATTCACAAAATCCATCACACACATGAGCAAATTTTTCTAAGGGGAGGAGGGAAGAAGGGGGA[G/A]
AGGGGTGTACTTCTGCGTCGGGCCATCCTCCTCTCCTCCACATCCGCCTTGCCGCCGCGCACCGCTGCCCCTCTTCACCTCGCCGCCGCACCGTGCCACT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.90% 1.70% 1.74% 56.71% NA
All Indica  2759 16.60% 0.10% 2.07% 81.15% NA
All Japonica  1512 72.40% 3.80% 0.93% 22.88% NA
Aus  269 78.10% 0.00% 0.74% 21.19% NA
Indica I  595 6.10% 0.00% 3.36% 90.59% NA
Indica II  465 28.00% 0.00% 1.51% 70.54% NA
Indica III  913 14.80% 0.10% 0.88% 84.23% NA
Indica Intermediate  786 20.10% 0.40% 2.80% 76.72% NA
Temperate Japonica  767 94.00% 0.10% 0.13% 5.74% NA
Tropical Japonica  504 39.50% 9.90% 2.38% 48.21% NA
Japonica Intermediate  241 72.20% 2.90% 0.41% 24.48% NA
VI/Aromatic  96 72.90% 13.50% 7.29% 6.25% NA
Intermediate  90 56.70% 5.60% 2.22% 35.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1220761649 C -> DEL N N silent_mutation Average:7.168; most accessible tissue: Callus, score: 26.637 N N N N
vg1220761649 C -> T LOC_Os12g34240.1 upstream_gene_variant ; 1058.0bp to feature; MODIFIER silent_mutation Average:7.168; most accessible tissue: Callus, score: 26.637 N N N N
vg1220761649 C -> T LOC_Os12g34250.1 upstream_gene_variant ; 1662.0bp to feature; MODIFIER silent_mutation Average:7.168; most accessible tissue: Callus, score: 26.637 N N N N
vg1220761649 C -> T LOC_Os12g34240-LOC_Os12g34250 intergenic_region ; MODIFIER silent_mutation Average:7.168; most accessible tissue: Callus, score: 26.637 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1220761649 1.62E-07 NA mr1301 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220761649 7.14E-07 NA mr1410 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220761649 1.91E-06 NA mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220761649 2.29E-07 NA mr1410_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251