\
| Variant ID: vg1220731451 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 20731451 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GAAGGATATACCTCATCTACCCACCGTCAGCAAGTTGAGGTTAGATGTGAACACATGGTGGCATGGCCATACCATTGGTGTAACCCTTGCAAGAATCATC[T/G]
AAAGGTGTAACAACATCGAAAACATCTCCATTCGCGTCCGTGGCTTGGTAAGCTTGATCACTTAGCATATTTAATTTGTATTCATTCACTTCCTTTTAAG
CTTAAAAGGAAGTGAATGAATACAAATTAAATATGCTAAGTGATCAAGCTTACCAAGCCACGGACGCGAATGGAGATGTTTTCGATGTTGTTACACCTTT[A/C]
GATGATTCTTGCAAGGGTTACACCAATGGTATGGCCATGCCACCATGTGTTCACATCTAACCTCAACTTGCTGACGGTGGGTAGATGAGGTATATCCTTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.20% | 21.60% | 0.17% | 0.00% | NA |
| All Indica | 2759 | 97.80% | 2.00% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 39.00% | 60.90% | 0.13% | 0.00% | NA |
| Aus | 269 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.30% | 2.20% | 0.50% | 0.00% | NA |
| Indica II | 465 | 96.10% | 3.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.00% | 0.90% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 97.80% | 1.90% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 9.80% | 90.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 78.00% | 21.80% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 50.20% | 49.40% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 70.00% | 30.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1220731451 | T -> G | LOC_Os12g34200.1 | splice_region_variant&intron_variant ; LOW | silent_mutation | Average:38.499; most accessible tissue: Callus, score: 80.206 | N | N | N | N |
| vg1220731451 | T -> G | LOC_Os12g34210.1 | upstream_gene_variant ; 1633.0bp to feature; MODIFIER | silent_mutation | Average:38.499; most accessible tissue: Callus, score: 80.206 | N | N | N | N |
| vg1220731451 | T -> G | LOC_Os12g34190.1 | downstream_gene_variant ; 4063.0bp to feature; MODIFIER | silent_mutation | Average:38.499; most accessible tissue: Callus, score: 80.206 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1220731451 | NA | 2.02E-06 | mr1013 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220731451 | NA | 2.59E-35 | mr1017 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220731451 | NA | 1.23E-33 | mr1055 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220731451 | NA | 5.84E-15 | mr1156 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220731451 | NA | 7.87E-06 | mr1157 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220731451 | NA | 6.28E-06 | mr1179 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220731451 | NA | 5.27E-06 | mr1328 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220731451 | 6.18E-55 | 2.11E-162 | mr1334 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220731451 | 6.98E-21 | 8.57E-35 | mr1334 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220731451 | NA | 9.03E-06 | mr1446 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220731451 | NA | 2.19E-06 | mr1577 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220731451 | NA | 1.20E-10 | mr1790 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220731451 | NA | 8.41E-08 | mr1864 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220731451 | NA | 1.08E-46 | mr1055_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220731451 | 9.21E-69 | 2.98E-190 | mr1334_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220731451 | 3.62E-21 | 5.97E-43 | mr1334_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220731451 | NA | 6.62E-60 | mr1390_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220731451 | NA | 2.11E-61 | mr1490_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220731451 | 4.58E-23 | 2.30E-75 | mr1991_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220731451 | 1.12E-14 | 2.68E-20 | mr1991_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |