\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220730650:

Variant ID: vg1220730650 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 20730650
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, C: 0.02, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:


TCCCATCGGTTGCTCTGATAACCTAAAGCCCAAAATTTGAATTTTGAAACTTAATTTTAAAATTGATTAATTTTAAGATATTTTGAGCACAGTTTCTTTT[T/C]
CGGTATTGTCTTTTGAATCATAAAAAAACATATATAAAATTTTTACCTATAAATTAATTTTCTTCCTAATAAACCAAAATTATTAGGGAATATGGGCAAC

Reverse complement sequence

GTTGCCCATATTCCCTAATAATTTTGGTTTATTAGGAAGAAAATTAATTTATAGGTAAAAATTTTATATATGTTTTTTTATGATTCAAAAGACAATACCG[A/G]
AAAAGAAACTGTGCTCAAAATATCTTAAAATTAATCAATTTTAAAATTAAGTTTCAAAATTCAAATTTTGGGCTTTAGGTTATCAGAGCAACCGATGGGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.50% 38.40% 1.80% 2.26% NA
All Indica  2759 69.90% 26.10% 1.30% 2.72% NA
All Japonica  1512 30.40% 65.40% 2.31% 1.92% NA
Aus  269 82.20% 16.70% 0.37% 0.74% NA
Indica I  595 88.90% 5.20% 2.35% 3.53% NA
Indica II  465 55.90% 37.80% 1.29% 4.95% NA
Indica III  913 60.20% 37.50% 0.66% 1.64% NA
Indica Intermediate  786 74.90% 21.80% 1.27% 2.04% NA
Temperate Japonica  767 6.90% 93.00% 0.13% 0.00% NA
Tropical Japonica  504 63.10% 25.00% 6.35% 5.56% NA
Japonica Intermediate  241 36.50% 62.20% 0.83% 0.41% NA
VI/Aromatic  96 69.80% 19.80% 9.38% 1.04% NA
Intermediate  90 47.80% 47.80% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1220730650 T -> C LOC_Os12g34180.1 upstream_gene_variant ; 4762.0bp to feature; MODIFIER silent_mutation Average:27.261; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg1220730650 T -> C LOC_Os12g34210.1 upstream_gene_variant ; 2434.0bp to feature; MODIFIER silent_mutation Average:27.261; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg1220730650 T -> C LOC_Os12g34190.1 downstream_gene_variant ; 3262.0bp to feature; MODIFIER silent_mutation Average:27.261; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg1220730650 T -> C LOC_Os12g34200.1 intron_variant ; MODIFIER silent_mutation Average:27.261; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg1220730650 T -> DEL N N silent_mutation Average:27.261; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1220730650 NA 2.31E-06 mr1006 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220730650 NA 7.93E-07 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220730650 NA 2.21E-06 mr1034 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220730650 NA 9.23E-07 mr1052 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220730650 NA 6.83E-06 mr1087 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220730650 NA 9.06E-10 mr1093 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220730650 NA 9.37E-06 mr1094 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220730650 NA 2.84E-06 mr1096 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220730650 NA 7.40E-06 mr1328 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220730650 3.33E-13 NA mr1334 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220730650 9.25E-14 4.42E-29 mr1334 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220730650 NA 8.67E-08 mr1403 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220730650 NA 3.36E-10 mr1539 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220730650 NA 1.15E-06 mr1671 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220730650 NA 4.71E-08 mr1942 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220730650 NA 1.53E-07 mr1090_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220730650 NA 1.66E-06 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220730650 NA 5.87E-07 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220730650 NA 5.44E-09 mr1235_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220730650 NA 1.05E-06 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220730650 NA 6.75E-06 mr1268_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220730650 NA 7.57E-07 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220730650 8.56E-10 NA mr1334_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220730650 5.87E-15 4.92E-36 mr1334_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220730650 NA 3.93E-06 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220730650 NA 1.49E-07 mr1933_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220730650 NA 1.35E-09 mr1942_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220730650 4.15E-11 3.37E-17 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251