\
| Variant ID: vg1220441290 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 20441290 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
ATGGATTCCTGCCAAAGATTGAGGTAACTCCAACTGATAAGCAACCTCTCCTCTTCTACTGACAATCTTATAAGGTCCCACAAAACGCGGTGCCAATTTT[T/C]
CCTTGGTATGAAAACGATGAACTCCTCGAAAAGGCGTGACACGAAGATACACATAGTCTCCTTCTTCAAAACTCAAATCTCTACGGCGATTGTCGGCATA
TATGCCGACAATCGCCGTAGAGATTTGAGTTTTGAAGAAGGAGACTATGTGTATCTTCGTGTCACGCCTTTTCGAGGAGTTCATCGTTTTCATACCAAGG[A/G]
AAAATTGGCACCGCGTTTTGTGGGACCTTATAAGATTGTCAGTAGAAGAGGAGAGGTTGCTTATCAGTTGGAGTTACCTCAATCTTTGGCAGGAATCCAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 20.40% | 2.50% | 21.88% | 55.23% | NA |
| All Indica | 2759 | 2.60% | 0.00% | 29.32% | 68.07% | NA |
| All Japonica | 1512 | 55.40% | 6.50% | 6.75% | 31.35% | NA |
| Aus | 269 | 7.40% | 4.80% | 26.39% | 61.34% | NA |
| Indica I | 595 | 3.40% | 0.00% | 12.61% | 84.03% | NA |
| Indica II | 465 | 4.70% | 0.00% | 27.74% | 67.53% | NA |
| Indica III | 913 | 1.20% | 0.00% | 41.07% | 57.72% | NA |
| Indica Intermediate | 786 | 2.40% | 0.00% | 29.26% | 68.32% | NA |
| Temperate Japonica | 767 | 84.70% | 6.50% | 3.13% | 5.61% | NA |
| Tropical Japonica | 504 | 11.90% | 2.60% | 10.52% | 75.00% | NA |
| Japonica Intermediate | 241 | 53.10% | 14.50% | 10.37% | 21.99% | NA |
| VI/Aromatic | 96 | 10.40% | 3.10% | 33.33% | 53.12% | NA |
| Intermediate | 90 | 26.70% | 4.40% | 22.22% | 46.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1220441290 | T -> C | LOC_Os12g33910.1 | missense_variant ; p.Glu1285Gly; MODERATE | nonsynonymous_codon ; E1285G | Average:6.979; most accessible tissue: Minghui63 flower, score: 11.139 | unknown | unknown | TOLERATED | 1.00 |
| vg1220441290 | T -> DEL | LOC_Os12g33910.1 | N | frameshift_variant | Average:6.979; most accessible tissue: Minghui63 flower, score: 11.139 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1220441290 | NA | 6.95E-10 | Awn_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1220441290 | 1.44E-06 | 1.17E-08 | mr1057 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220441290 | NA | 6.01E-08 | mr1057 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220441290 | NA | 8.38E-08 | mr1201 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220441290 | NA | 1.16E-06 | mr1219 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220441290 | NA | 7.57E-07 | mr1274 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220441290 | 9.17E-06 | NA | mr1565 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220441290 | 5.52E-06 | NA | mr1887 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220441290 | NA | 2.32E-08 | mr1057_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220441290 | NA | 8.85E-10 | mr1057_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220441290 | NA | 6.89E-08 | mr1624_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |