\
| Variant ID: vg1220409045 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 20409045 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.83, C: 0.17, others allele: 0.00, population size: 59. )
AAGAGGAAACAACTTTAACTTAAGCAAATCATTACTACCAACCTTACCACATTGATCAATAAATTGGCCGATATGCTCCATTTTTGTTCTAGCATCCTCA[G/C]
CTGTGAATTTCGTGAAGTTGGGCACCTCAAATCCTTGCGGGTATGGGACCGAATCTACATGTTCAGGATACGGCCTTTGATATGTATGCATAACTATTTT
AAAATAGTTATGCATACATATCAAAGGCCGTATCCTGAACATGTAGATTCGGTCCCATACCCGCAAGGATTTGAGGTGCCCAACTTCACGAAATTCACAG[C/G]
TGAGGATGCTAGAACAAAAATGGAGCATATCGGCCAATTTATTGATCAATGTGGTAAGGTTGGTAGTAATGATTTGCTTAAGTTAAAGTTGTTTCCTCTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 29.80% | 24.20% | 23.85% | 22.13% | NA |
| All Indica | 2759 | 12.40% | 30.90% | 27.04% | 29.61% | NA |
| All Japonica | 1512 | 64.60% | 14.00% | 11.90% | 9.46% | NA |
| Aus | 269 | 14.10% | 16.00% | 48.70% | 21.19% | NA |
| Indica I | 595 | 32.60% | 6.90% | 23.87% | 36.64% | NA |
| Indica II | 465 | 10.50% | 38.70% | 20.43% | 30.32% | NA |
| Indica III | 913 | 1.00% | 46.40% | 28.59% | 23.99% | NA |
| Indica Intermediate | 786 | 11.60% | 26.50% | 31.55% | 30.41% | NA |
| Temperate Japonica | 767 | 94.30% | 0.90% | 2.09% | 2.74% | NA |
| Tropical Japonica | 504 | 18.50% | 35.30% | 25.60% | 20.63% | NA |
| Japonica Intermediate | 241 | 66.80% | 11.20% | 14.52% | 7.47% | NA |
| VI/Aromatic | 96 | 8.30% | 18.80% | 53.12% | 19.79% | NA |
| Intermediate | 90 | 45.60% | 22.20% | 21.11% | 11.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1220409045 | G -> C | LOC_Os12g33840.1 | downstream_gene_variant ; 3710.0bp to feature; MODIFIER | silent_mutation | Average:8.569; most accessible tissue: Callus, score: 19.417 | N | N | N | N |
| vg1220409045 | G -> C | LOC_Os12g33840-LOC_Os12g33870 | intergenic_region ; MODIFIER | silent_mutation | Average:8.569; most accessible tissue: Callus, score: 19.417 | N | N | N | N |
| vg1220409045 | G -> DEL | N | N | silent_mutation | Average:8.569; most accessible tissue: Callus, score: 19.417 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1220409045 | NA | 2.40E-06 | mr1121 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220409045 | 2.16E-17 | 1.28E-107 | mr1334 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220409045 | NA | 1.54E-06 | mr1334 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220409045 | 4.80E-08 | 8.41E-22 | mr1334 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220409045 | NA | 1.61E-20 | mr1588 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220409045 | NA | 4.55E-06 | mr1588 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220409045 | 2.41E-18 | 6.49E-117 | mr1334_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220409045 | 5.96E-07 | 3.39E-24 | mr1334_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220409045 | 1.68E-06 | 1.68E-06 | mr1335_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220409045 | NA | 1.39E-26 | mr1588_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220409045 | 8.53E-07 | 3.05E-09 | mr1588_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220409045 | 4.29E-06 | 2.90E-51 | mr1991_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220409045 | NA | 6.32E-11 | mr1991_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |