\
| Variant ID: vg1220408794 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 20408794 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.85, C: 0.14, others allele: 0.00, population size: 55. )
ATAACACTTTTCCCTTTCTTTTTGTCAACATCAATAGGACTAACAGGAAGAGGATCACTAACAATTCCGGTCTTAGGCATAGATGTAACCGAATTAGTTT[T/C]
ACAAGTGACCGATAAAGTATCAATCGGTCTTTGCTCCATCAAGCTTGCATCTTTGAAATAACCATGAAACTCATGCTCCATTTGTGACCATGTAGAAATT
AATTTCTACATGGTCACAAATGGAGCATGAGTTTCATGGTTATTTCAAAGATGCAAGCTTGATGGAGCAAAGACCGATTGATACTTTATCGGTCACTTGT[A/G]
AAACTAATTCGGTTACATCTATGCCTAAGACCGGAATTGTTAGTGATCCTCTTCCTGTTAGTCCTATTGATGTTGACAAAAAGAAAGGGAAAAGTGTTAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 30.40% | 15.10% | 13.12% | 41.30% | NA |
| All Indica | 2759 | 13.10% | 23.70% | 15.48% | 47.73% | NA |
| All Japonica | 1512 | 65.30% | 1.20% | 10.25% | 23.21% | NA |
| Aus | 269 | 14.10% | 10.40% | 2.23% | 73.23% | NA |
| Indica I | 595 | 33.90% | 2.90% | 9.08% | 54.12% | NA |
| Indica II | 465 | 11.40% | 32.90% | 4.73% | 50.97% | NA |
| Indica III | 913 | 1.00% | 36.60% | 24.53% | 37.90% | NA |
| Indica Intermediate | 786 | 12.30% | 19.10% | 16.16% | 52.42% | NA |
| Temperate Japonica | 767 | 94.40% | 0.30% | 0.65% | 4.69% | NA |
| Tropical Japonica | 504 | 20.20% | 3.20% | 22.42% | 54.17% | NA |
| Japonica Intermediate | 241 | 67.20% | 0.00% | 15.35% | 17.43% | NA |
| VI/Aromatic | 96 | 10.40% | 2.10% | 25.00% | 62.50% | NA |
| Intermediate | 90 | 46.70% | 14.40% | 8.89% | 30.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1220408794 | T -> C | LOC_Os12g33840.1 | downstream_gene_variant ; 3459.0bp to feature; MODIFIER | silent_mutation | Average:10.104; most accessible tissue: Callus, score: 18.35 | N | N | N | N |
| vg1220408794 | T -> C | LOC_Os12g33840-LOC_Os12g33870 | intergenic_region ; MODIFIER | silent_mutation | Average:10.104; most accessible tissue: Callus, score: 18.35 | N | N | N | N |
| vg1220408794 | T -> DEL | N | N | silent_mutation | Average:10.104; most accessible tissue: Callus, score: 18.35 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1220408794 | NA | 9.07E-06 | mr1011 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220408794 | 4.63E-06 | 2.06E-06 | mr1630 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220408794 | NA | 1.39E-06 | mr1815 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220408794 | NA | 8.04E-08 | mr1308_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220408794 | 2.21E-06 | 6.44E-08 | mr1350_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220408794 | 9.70E-06 | 5.39E-09 | mr1361_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220408794 | NA | 2.82E-07 | mr1422_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220408794 | 7.89E-07 | 7.88E-07 | mr1562_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220408794 | 6.87E-06 | 2.37E-06 | mr1818_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220408794 | NA | 8.75E-07 | mr1853_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220408794 | 2.28E-06 | 5.88E-08 | mr1884_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |