\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220408794:

Variant ID: vg1220408794 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 20408794
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.85, C: 0.14, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:


ATAACACTTTTCCCTTTCTTTTTGTCAACATCAATAGGACTAACAGGAAGAGGATCACTAACAATTCCGGTCTTAGGCATAGATGTAACCGAATTAGTTT[T/C]
ACAAGTGACCGATAAAGTATCAATCGGTCTTTGCTCCATCAAGCTTGCATCTTTGAAATAACCATGAAACTCATGCTCCATTTGTGACCATGTAGAAATT

Reverse complement sequence

AATTTCTACATGGTCACAAATGGAGCATGAGTTTCATGGTTATTTCAAAGATGCAAGCTTGATGGAGCAAAGACCGATTGATACTTTATCGGTCACTTGT[A/G]
AAACTAATTCGGTTACATCTATGCCTAAGACCGGAATTGTTAGTGATCCTCTTCCTGTTAGTCCTATTGATGTTGACAAAAAGAAAGGGAAAAGTGTTAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 30.40% 15.10% 13.12% 41.30% NA
All Indica  2759 13.10% 23.70% 15.48% 47.73% NA
All Japonica  1512 65.30% 1.20% 10.25% 23.21% NA
Aus  269 14.10% 10.40% 2.23% 73.23% NA
Indica I  595 33.90% 2.90% 9.08% 54.12% NA
Indica II  465 11.40% 32.90% 4.73% 50.97% NA
Indica III  913 1.00% 36.60% 24.53% 37.90% NA
Indica Intermediate  786 12.30% 19.10% 16.16% 52.42% NA
Temperate Japonica  767 94.40% 0.30% 0.65% 4.69% NA
Tropical Japonica  504 20.20% 3.20% 22.42% 54.17% NA
Japonica Intermediate  241 67.20% 0.00% 15.35% 17.43% NA
VI/Aromatic  96 10.40% 2.10% 25.00% 62.50% NA
Intermediate  90 46.70% 14.40% 8.89% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1220408794 T -> C LOC_Os12g33840.1 downstream_gene_variant ; 3459.0bp to feature; MODIFIER silent_mutation Average:10.104; most accessible tissue: Callus, score: 18.35 N N N N
vg1220408794 T -> C LOC_Os12g33840-LOC_Os12g33870 intergenic_region ; MODIFIER silent_mutation Average:10.104; most accessible tissue: Callus, score: 18.35 N N N N
vg1220408794 T -> DEL N N silent_mutation Average:10.104; most accessible tissue: Callus, score: 18.35 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1220408794 NA 9.07E-06 mr1011 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220408794 4.63E-06 2.06E-06 mr1630 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220408794 NA 1.39E-06 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220408794 NA 8.04E-08 mr1308_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220408794 2.21E-06 6.44E-08 mr1350_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220408794 9.70E-06 5.39E-09 mr1361_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220408794 NA 2.82E-07 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220408794 7.89E-07 7.88E-07 mr1562_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220408794 6.87E-06 2.37E-06 mr1818_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220408794 NA 8.75E-07 mr1853_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220408794 2.28E-06 5.88E-08 mr1884_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251