Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220405263:

Variant ID: vg1220405263 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 20405263
Reference Allele: C	Alternative Allele: G
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCTCAGATCCTCTCTGTCTATGTGGCCAACCGGAGGATTGGGAGGACCAGATGATCCCATTAGAGCATCTGAAGAACATCGAGATCCGTGGGTTTGCGCC[C/G]
TTTAAAGATGACCGAAAACGGCTCGTGCGACTACTGTTAAAACAGACTCGGACTCGGACCCTGACGGTCTGACCGCCCACATACCTGCGGTCAGACCAGC

Reverse complement sequence

GCTGGTCTGACCGCAGGTATGTGGGCGGTCAGACCGTCAGGGTCCGAGTCCGAGTCTGTTTTAACAGTAGTCGCACGAGCCGTTTTCGGTCATCTTTAAA[G/C]
GGCGCAAACCCACGGATCTCGATGTTCTTCAGATGCTCTAATGGGATCATCTGGTCCTCCCAATCCTCCGGTTGGCCACATAGACAGAGAGGATCTGAGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.10%	26.70%	3.58%	13.61%	NA
All Indica	2759	80.90%	8.80%	2.28%	8.08%	NA
All Japonica	1512	12.30%	63.20%	3.84%	20.63%	NA
Aus	269	60.20%	8.90%	11.15%	19.70%	NA
Indica I	595	55.80%	22.50%	5.55%	16.13%	NA
Indica II	465	91.40%	7.10%	0.65%	0.86%	NA
Indica III	913	90.70%	0.40%	1.20%	7.67%	NA
Indica Intermediate	786	82.20%	9.00%	2.04%	6.74%	NA
Temperate Japonica	767	3.10%	93.70%	0.65%	2.48%	NA
Tropical Japonica	504	25.60%	16.30%	7.34%	50.79%	NA
Japonica Intermediate	241	13.70%	64.30%	6.64%	15.35%	NA
VI/Aromatic	96	35.40%	7.30%	10.42%	46.88%	NA
Intermediate	90	43.30%	36.70%	8.89%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1220405263	C -> DEL	LOC_Os12g33840.1	N	frameshift_variant	Average:35.758; most accessible tissue: Callus, score: 71.509	N	N	N	N
vg1220405263	C -> G	LOC_Os12g33840.1	synonymous_variant ; p.Pro91Pro; LOW	synonymous_codon	Average:35.758; most accessible tissue: Callus, score: 71.509	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1220405263	NA	1.79E-07	mr1013	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220405263	NA	4.66E-34	mr1017	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220405263	NA	1.58E-06	mr1034	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220405263	NA	1.73E-41	mr1093	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220405263	NA	2.08E-11	mr1093	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220405263	NA	1.81E-15	mr1156	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220405263	NA	3.96E-10	mr1235	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220405263	NA	9.36E-10	mr1251	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220405263	NA	3.85E-07	mr1252	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220405263	2.32E-42	7.87E-153	mr1334	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220405263	3.45E-19	1.95E-35	mr1334	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220405263	NA	3.33E-07	mr1403	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220405263	NA	3.64E-11	mr1435	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220405263	NA	1.04E-10	mr1539	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220405263	NA	2.79E-07	mr1599	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220405263	NA	5.98E-07	mr1671	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220405263	NA	1.03E-45	mr1771	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220405263	NA	2.70E-13	mr1771	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220405263	NA	2.27E-36	mr1784	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220405263	NA	1.21E-09	mr1790	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220405263	NA	9.06E-09	mr1864	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220405263	NA	2.34E-12	mr1248_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220405263	NA	5.10E-06	mr1268_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220405263	2.11E-60	7.29E-185	mr1334_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220405263	3.95E-22	5.01E-45	mr1334_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220405263	NA	2.86E-14	mr1790_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220405263	NA	1.52E-07	mr1817_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220405263	3.71E-23	4.19E-76	mr1991_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220405263	7.10E-15	1.33E-19	mr1991_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251