Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220404712:

Variant ID: vg1220404712 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 20404712
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTTTTAGAAATGCTAGTCCTTACAAAATTGATTCAATGCCTGATAGTAGCATGCCGGAATTTTAATCAACCCTGTCACCCACAGAATCAAATTAAAAT[C/A]
AATTATCCCATTCTGAAAAAAAAAATGTGATCATCATTCATATAATTTTGTTTCAATTGTGTATTTTCCTCTAGACACTAACTATATATTTATTAATCTT

Reverse complement sequence

AAGATTAATAAATATATAGTTAGTGTCTAGAGGAAAATACACAATTGAAACAAAATTATATGAATGATGATCACATTTTTTTTTTCAGAATGGGATAATT[G/T]
ATTTTAATTTGATTCTGTGGGTGACAGGGTTGATTAAAATTCCGGCATGCTACTATCAGGCATTGAATCAATTTTGTAAGGACTAGCATTTCTAAAAAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.80%	21.30%	0.59%	1.25%	NA
All Indica	2759	87.20%	12.30%	0.47%	0.04%	NA
All Japonica	1512	65.70%	30.70%	0.40%	3.24%	NA
Aus	269	55.00%	42.80%	2.23%	0.00%	NA
Indica I	595	75.00%	23.90%	1.18%	0.00%	NA
Indica II	465	98.50%	1.50%	0.00%	0.00%	NA
Indica III	913	87.10%	12.60%	0.22%	0.11%	NA
Indica Intermediate	786	89.90%	9.50%	0.51%	0.00%	NA
Temperate Japonica	767	95.20%	4.80%	0.00%	0.00%	NA
Tropical Japonica	504	20.60%	69.00%	0.60%	9.72%	NA
Japonica Intermediate	241	66.00%	32.80%	1.24%	0.00%	NA
VI/Aromatic	96	17.70%	70.80%	2.08%	9.38%	NA
Intermediate	90	74.40%	24.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1220404712	C -> DEL	N	N	silent_mutation	Average:29.611; most accessible tissue: Callus, score: 76.795	N	N	N	N
vg1220404712	C -> A	LOC_Os12g33840.1	upstream_gene_variant ; 119.0bp to feature; MODIFIER	silent_mutation	Average:29.611; most accessible tissue: Callus, score: 76.795	N	N	N	N
vg1220404712	C -> A	LOC_Os12g33830.1	downstream_gene_variant ; 3152.0bp to feature; MODIFIER	silent_mutation	Average:29.611; most accessible tissue: Callus, score: 76.795	N	N	N	N
vg1220404712	C -> A	LOC_Os12g33830-LOC_Os12g33840	intergenic_region ; MODIFIER	silent_mutation	Average:29.611; most accessible tissue: Callus, score: 76.795	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1220404712	NA	3.34E-06	mr1013	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220404712	NA	5.93E-06	mr1034	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220404712	NA	4.64E-06	mr1179	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220404712	5.85E-10	NA	mr1334	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220404712	2.03E-11	8.47E-26	mr1334	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220404712	NA	4.20E-09	mr1403	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220404712	1.78E-10	NA	mr1334_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220404712	1.80E-12	1.96E-31	mr1334_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220404712	NA	1.27E-06	mr1807_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220404712	3.12E-06	NA	mr1991_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220404712	2.95E-10	1.68E-16	mr1991_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251