| Variant ID: vg1220378676 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 20378676 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AAAAGCTAGGCACAACATATATATGTGATTTGTGCATTGCAATGGGAAAAAAAGATCAATCTGTCCATTGCATTTTTCCATTCAGATCTTTTCAGCATTT[T/A]
TAAAAGACTATCAATAGAACGAACTCAATTAAATCCATTAATGTTGTTTTTGATGATATCTACTTCCTCCGTTTCACAATGTAAGCCATTCTAGCATTCT
AGAATGCTAGAATGGCTTACATTGTGAAACGGAGGAAGTAGATATCATCAAAAACAACATTAATGGATTTAATTGAGTTCGTTCTATTGATAGTCTTTTA[A/T]
AAATGCTGAAAAGATCTGAATGGAAAAATGCAATGGACAGATTGATCTTTTTTTCCCATTGCAATGCACAAATCACATATATATGTTGTGCCTAGCTTTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 43.20% | 40.40% | 1.16% | 15.26% | NA |
| All Indica | 2759 | 32.50% | 56.80% | 1.05% | 9.64% | NA |
| All Japonica | 1512 | 68.50% | 4.40% | 1.46% | 25.66% | NA |
| Aus | 269 | 19.30% | 79.90% | 0.37% | 0.37% | NA |
| Indica I | 595 | 28.10% | 52.80% | 2.86% | 16.30% | NA |
| Indica II | 465 | 39.60% | 57.60% | 0.65% | 2.15% | NA |
| Indica III | 913 | 36.70% | 50.80% | 0.44% | 12.05% | NA |
| Indica Intermediate | 786 | 26.80% | 66.30% | 0.64% | 6.23% | NA |
| Temperate Japonica | 767 | 94.10% | 1.60% | 0.26% | 4.04% | NA |
| Tropical Japonica | 504 | 31.30% | 5.00% | 1.19% | 62.50% | NA |
| Japonica Intermediate | 241 | 64.70% | 12.00% | 5.81% | 17.43% | NA |
| VI/Aromatic | 96 | 11.50% | 30.20% | 1.04% | 57.29% | NA |
| Intermediate | 90 | 51.10% | 34.40% | 2.22% | 12.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1220378676 | T -> DEL | N | N | silent_mutation | Average:24.79; most accessible tissue: Callus, score: 74.36 | N | N | N | N |
| vg1220378676 | T -> A | LOC_Os12g33780.1 | downstream_gene_variant ; 1419.0bp to feature; MODIFIER | silent_mutation | Average:24.79; most accessible tissue: Callus, score: 74.36 | N | N | N | N |
| vg1220378676 | T -> A | LOC_Os12g33780-LOC_Os12g33800 | intergenic_region ; MODIFIER | silent_mutation | Average:24.79; most accessible tissue: Callus, score: 74.36 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1220378676 | 2.27E-06 | NA | mr1127 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220378676 | 7.03E-07 | 2.60E-07 | mr1127 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220378676 | 4.19E-07 | NA | mr1334 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220378676 | NA | 1.93E-06 | mr1445 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220378676 | NA | 6.07E-06 | mr1516 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220378676 | NA | 5.21E-07 | mr1574 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220378676 | NA | 3.92E-06 | mr1815 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220378676 | NA | 2.68E-11 | mr1921 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220378676 | NA | 2.68E-07 | mr1991_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |