\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220367571:

Variant ID: vg1220367571 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 20367571
Reference Allele: CAlternative Allele: G
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGGGATTTTTTTTTTGGGAAGCAAAGCAGTGAGATGCAAAAGAGGATAAGGTTGTGCGAAGGATGGGTTAAATCAATGGTGGGCTCCACCGTACGTTTTT[C/G]
TCCGATATTTTTCGTCCCGTCGGATGGCAGATGCAAAGCATTTTCCATGTTGCCAAATGCTTTTCGGATATGGAAATAAGTTTTCGAGTGCTTTGTTTAT

Reverse complement sequence

ATAAACAAAGCACTCGAAAACTTATTTCCATATCCGAAAAGCATTTGGCAACATGGAAAATGCTTTGCATCTGCCATCCGACGGGACGAAAAATATCGGA[G/C]
AAAAACGTACGGTGGAGCCCACCATTGATTTAACCCATCCTTCGCACAACCTTATCCTCTTTTGCATCTCACTGCTTTGCTTCCCAAAAAAAAAATCCCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.60% 29.30% 1.06% 16.99% NA
All Indica  2759 65.50% 10.00% 1.63% 22.94% NA
All Japonica  1512 29.00% 67.30% 0.00% 3.77% NA
Aus  269 43.50% 19.00% 1.12% 36.43% NA
Indica I  595 65.20% 27.20% 4.37% 3.19% NA
Indica II  465 59.10% 8.00% 1.72% 31.18% NA
Indica III  913 63.60% 0.90% 0.22% 35.27% NA
Indica Intermediate  786 71.50% 8.70% 1.15% 18.70% NA
Temperate Japonica  767 5.50% 94.00% 0.00% 0.52% NA
Tropical Japonica  504 68.30% 27.80% 0.00% 3.97% NA
Japonica Intermediate  241 21.60% 64.70% 0.00% 13.69% NA
VI/Aromatic  96 87.50% 8.30% 0.00% 4.17% NA
Intermediate  90 46.70% 38.90% 2.22% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1220367571 C -> DEL N N silent_mutation Average:33.4; most accessible tissue: Callus, score: 79.023 N N N N
vg1220367571 C -> G LOC_Os12g33770.1 upstream_gene_variant ; 3430.0bp to feature; MODIFIER silent_mutation Average:33.4; most accessible tissue: Callus, score: 79.023 N N N N
vg1220367571 C -> G LOC_Os12g33750.1 downstream_gene_variant ; 2223.0bp to feature; MODIFIER silent_mutation Average:33.4; most accessible tissue: Callus, score: 79.023 N N N N
vg1220367571 C -> G LOC_Os12g33760.1 downstream_gene_variant ; 2308.0bp to feature; MODIFIER silent_mutation Average:33.4; most accessible tissue: Callus, score: 79.023 N N N N
vg1220367571 C -> G LOC_Os12g33750-LOC_Os12g33760 intergenic_region ; MODIFIER silent_mutation Average:33.4; most accessible tissue: Callus, score: 79.023 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1220367571 NA 6.36E-06 mr1304 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220367571 NA 4.74E-06 mr1308 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220367571 1.95E-11 NA mr1334 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220367571 4.11E-12 5.09E-27 mr1334 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220367571 NA 6.05E-06 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220367571 9.96E-07 9.96E-07 mr1545 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220367571 NA 1.46E-07 mr1599 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220367571 NA 3.78E-06 mr1614 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220367571 NA 2.28E-06 mr1671 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220367571 NA 2.71E-06 mr1968 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220367571 3.77E-09 NA mr1334_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220367571 1.43E-11 6.67E-32 mr1334_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220367571 1.85E-07 8.22E-14 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251