\
| Variant ID: vg1220367571 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 20367571 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TGGGATTTTTTTTTTGGGAAGCAAAGCAGTGAGATGCAAAAGAGGATAAGGTTGTGCGAAGGATGGGTTAAATCAATGGTGGGCTCCACCGTACGTTTTT[C/G]
TCCGATATTTTTCGTCCCGTCGGATGGCAGATGCAAAGCATTTTCCATGTTGCCAAATGCTTTTCGGATATGGAAATAAGTTTTCGAGTGCTTTGTTTAT
ATAAACAAAGCACTCGAAAACTTATTTCCATATCCGAAAAGCATTTGGCAACATGGAAAATGCTTTGCATCTGCCATCCGACGGGACGAAAAATATCGGA[G/C]
AAAAACGTACGGTGGAGCCCACCATTGATTTAACCCATCCTTCGCACAACCTTATCCTCTTTTGCATCTCACTGCTTTGCTTCCCAAAAAAAAAATCCCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.60% | 29.30% | 1.06% | 16.99% | NA |
| All Indica | 2759 | 65.50% | 10.00% | 1.63% | 22.94% | NA |
| All Japonica | 1512 | 29.00% | 67.30% | 0.00% | 3.77% | NA |
| Aus | 269 | 43.50% | 19.00% | 1.12% | 36.43% | NA |
| Indica I | 595 | 65.20% | 27.20% | 4.37% | 3.19% | NA |
| Indica II | 465 | 59.10% | 8.00% | 1.72% | 31.18% | NA |
| Indica III | 913 | 63.60% | 0.90% | 0.22% | 35.27% | NA |
| Indica Intermediate | 786 | 71.50% | 8.70% | 1.15% | 18.70% | NA |
| Temperate Japonica | 767 | 5.50% | 94.00% | 0.00% | 0.52% | NA |
| Tropical Japonica | 504 | 68.30% | 27.80% | 0.00% | 3.97% | NA |
| Japonica Intermediate | 241 | 21.60% | 64.70% | 0.00% | 13.69% | NA |
| VI/Aromatic | 96 | 87.50% | 8.30% | 0.00% | 4.17% | NA |
| Intermediate | 90 | 46.70% | 38.90% | 2.22% | 12.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1220367571 | C -> DEL | N | N | silent_mutation | Average:33.4; most accessible tissue: Callus, score: 79.023 | N | N | N | N |
| vg1220367571 | C -> G | LOC_Os12g33770.1 | upstream_gene_variant ; 3430.0bp to feature; MODIFIER | silent_mutation | Average:33.4; most accessible tissue: Callus, score: 79.023 | N | N | N | N |
| vg1220367571 | C -> G | LOC_Os12g33750.1 | downstream_gene_variant ; 2223.0bp to feature; MODIFIER | silent_mutation | Average:33.4; most accessible tissue: Callus, score: 79.023 | N | N | N | N |
| vg1220367571 | C -> G | LOC_Os12g33760.1 | downstream_gene_variant ; 2308.0bp to feature; MODIFIER | silent_mutation | Average:33.4; most accessible tissue: Callus, score: 79.023 | N | N | N | N |
| vg1220367571 | C -> G | LOC_Os12g33750-LOC_Os12g33760 | intergenic_region ; MODIFIER | silent_mutation | Average:33.4; most accessible tissue: Callus, score: 79.023 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1220367571 | NA | 6.36E-06 | mr1304 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220367571 | NA | 4.74E-06 | mr1308 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220367571 | 1.95E-11 | NA | mr1334 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220367571 | 4.11E-12 | 5.09E-27 | mr1334 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220367571 | NA | 6.05E-06 | mr1531 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220367571 | 9.96E-07 | 9.96E-07 | mr1545 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220367571 | NA | 1.46E-07 | mr1599 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220367571 | NA | 3.78E-06 | mr1614 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220367571 | NA | 2.28E-06 | mr1671 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220367571 | NA | 2.71E-06 | mr1968 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220367571 | 3.77E-09 | NA | mr1334_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220367571 | 1.43E-11 | 6.67E-32 | mr1334_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220367571 | 1.85E-07 | 8.22E-14 | mr1991_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |