Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1220360753:

Variant ID: vg1220360753 (JBrowse)	Variation Type: INDEL
Chromosome: chr12	Position: 20360753
Reference Allele: C	Alternative Allele: A,CCG
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 54. )

Flanking Sequence (100 bp) in Reference Genome:

AGTGTCCATTTGGATGACGGTTGGAGCGCCGGAAACGGTCATAACCGTCATTGGGAAGCAGTTATCTACCGAACTGGACTTGGGCCGGGGTAAACGGCCT[C/A,CCG]
TGCCAGGGTTTGGCCGAACTCAGGGGTTCGGCTGAACCCGGGACGGCTCCGTTCGCTCCGGTTTTCATCCTGGACACTCATTTTGGGCCCCCCCCAATTC

Reverse complement sequence

GAATTGGGGGGGGCCCAAAATGAGTGTCCAGGATGAAAACCGGAGCGAACGGAGCCGTCCCGGGTTCAGCCGAACCCCTGAGTTCGGCCAAACCCTGGCA[G/T,CGG]
AGGCCGTTTACCCCGGCCCAAGTCCAGTTCGGTAGATAACTGCTTCCCAATGACGGTTATGACCGTTTCCGGCGCTCCAACCGTCATCCAAATGGACACT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	32.20%	16.90%	8.63%	42.17%	CCG: 0.06%
All Indica	2759	14.80%	18.60%	12.00%	54.48%	CCG: 0.07%
All Japonica	1512	67.50%	16.40%	1.79%	14.29%	CCG: 0.07%
Aus	269	16.00%	0.00%	14.87%	69.14%	NA
Indica I	595	36.80%	35.80%	7.56%	19.83%	NA
Indica II	465	12.70%	10.80%	11.40%	65.16%	NA
Indica III	913	2.40%	12.40%	14.02%	71.08%	CCG: 0.11%
Indica Intermediate	786	13.90%	17.60%	13.36%	55.09%	CCG: 0.13%
Temperate Japonica	767	94.10%	2.20%	0.65%	3.00%	NA
Tropical Japonica	504	27.60%	43.70%	3.97%	24.60%	CCG: 0.20%
Japonica Intermediate	241	66.00%	4.60%	0.83%	28.63%	NA
VI/Aromatic	96	11.50%	16.70%	6.25%	65.62%	NA
Intermediate	90	45.60%	22.20%	4.44%	27.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1220360753	C -> CCG	LOC_Os12g33750.1	upstream_gene_variant ; 4211.0bp to feature; MODIFIER	silent_mutation	Average:22.263; most accessible tissue: Minghui63 root, score: 35.002	N	N	N	N
vg1220360753	C -> CCG	LOC_Os12g33730.1	downstream_gene_variant ; 3742.0bp to feature; MODIFIER	silent_mutation	Average:22.263; most accessible tissue: Minghui63 root, score: 35.002	N	N	N	N
vg1220360753	C -> CCG	LOC_Os12g33740.1	downstream_gene_variant ; 1716.0bp to feature; MODIFIER	silent_mutation	Average:22.263; most accessible tissue: Minghui63 root, score: 35.002	N	N	N	N
vg1220360753	C -> CCG	LOC_Os12g33740-LOC_Os12g33750	intergenic_region ; MODIFIER	silent_mutation	Average:22.263; most accessible tissue: Minghui63 root, score: 35.002	N	N	N	N
vg1220360753	C -> A	LOC_Os12g33750.1	upstream_gene_variant ; 4212.0bp to feature; MODIFIER	silent_mutation	Average:22.263; most accessible tissue: Minghui63 root, score: 35.002	N	N	N	N
vg1220360753	C -> A	LOC_Os12g33730.1	downstream_gene_variant ; 3741.0bp to feature; MODIFIER	silent_mutation	Average:22.263; most accessible tissue: Minghui63 root, score: 35.002	N	N	N	N
vg1220360753	C -> A	LOC_Os12g33740.1	downstream_gene_variant ; 1715.0bp to feature; MODIFIER	silent_mutation	Average:22.263; most accessible tissue: Minghui63 root, score: 35.002	N	N	N	N
vg1220360753	C -> A	LOC_Os12g33740-LOC_Os12g33750	intergenic_region ; MODIFIER	silent_mutation	Average:22.263; most accessible tissue: Minghui63 root, score: 35.002	N	N	N	N
vg1220360753	C -> DEL	N	N	silent_mutation	Average:22.263; most accessible tissue: Minghui63 root, score: 35.002	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1220360753	7.91E-07	NA	mr1334	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251