\
| Variant ID: vg1220360743 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 20360743 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.87, T: 0.13, others allele: 0.00, population size: 46. )
CCTCATGCCAAGTGTCCATTTGGATGACGGTTGGAGCGCCGGAAACGGTCATAACCGTCATTGGGAAGCAGTTATCTACCGAACTGGACTTGGGCCGGGG[T/C]
AAACGGCCTCTGCCAGGGTTTGGCCGAACTCAGGGGTTCGGCTGAACCCGGGACGGCTCCGTTCGCTCCGGTTTTCATCCTGGACACTCATTTTGGGCCC
GGGCCCAAAATGAGTGTCCAGGATGAAAACCGGAGCGAACGGAGCCGTCCCGGGTTCAGCCGAACCCCTGAGTTCGGCCAAACCCTGGCAGAGGCCGTTT[A/G]
CCCCGGCCCAAGTCCAGTTCGGTAGATAACTGCTTCCCAATGACGGTTATGACCGTTTCCGGCGCTCCAACCGTCATCCAAATGGACACTTGGCATGAGG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 29.20% | 21.30% | 9.14% | 40.33% | NA |
| All Indica | 2759 | 13.30% | 24.10% | 12.54% | 50.09% | NA |
| All Japonica | 1512 | 61.20% | 20.00% | 1.85% | 16.93% | NA |
| Aus | 269 | 15.60% | 0.70% | 15.24% | 68.40% | NA |
| Indica I | 595 | 33.80% | 37.30% | 10.59% | 18.32% | NA |
| Indica II | 465 | 11.00% | 15.50% | 11.40% | 62.15% | NA |
| Indica III | 913 | 2.20% | 20.50% | 13.36% | 63.96% | NA |
| Indica Intermediate | 786 | 12.10% | 23.30% | 13.74% | 50.89% | NA |
| Temperate Japonica | 767 | 89.40% | 5.10% | 0.91% | 4.56% | NA |
| Tropical Japonica | 504 | 23.40% | 43.80% | 3.77% | 28.97% | NA |
| Japonica Intermediate | 241 | 50.20% | 17.80% | 0.83% | 31.12% | NA |
| VI/Aromatic | 96 | 9.40% | 18.80% | 7.29% | 64.58% | NA |
| Intermediate | 90 | 40.00% | 24.40% | 11.11% | 24.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1220360743 | T -> C | LOC_Os12g33750.1 | upstream_gene_variant ; 4222.0bp to feature; MODIFIER | silent_mutation | Average:22.101; most accessible tissue: Minghui63 root, score: 35.002 | N | N | N | N |
| vg1220360743 | T -> C | LOC_Os12g33730.1 | downstream_gene_variant ; 3731.0bp to feature; MODIFIER | silent_mutation | Average:22.101; most accessible tissue: Minghui63 root, score: 35.002 | N | N | N | N |
| vg1220360743 | T -> C | LOC_Os12g33740.1 | downstream_gene_variant ; 1705.0bp to feature; MODIFIER | silent_mutation | Average:22.101; most accessible tissue: Minghui63 root, score: 35.002 | N | N | N | N |
| vg1220360743 | T -> C | LOC_Os12g33740-LOC_Os12g33750 | intergenic_region ; MODIFIER | silent_mutation | Average:22.101; most accessible tissue: Minghui63 root, score: 35.002 | N | N | N | N |
| vg1220360743 | T -> DEL | N | N | silent_mutation | Average:22.101; most accessible tissue: Minghui63 root, score: 35.002 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1220360743 | 1.64E-16 | 2.85E-85 | mr1334 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220360743 | 5.95E-12 | 6.97E-24 | mr1334 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220360743 | 4.35E-20 | 3.18E-97 | mr1334_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220360743 | 3.47E-06 | 3.84E-08 | mr1334_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220360743 | 3.50E-10 | 1.06E-26 | mr1334_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220360743 | 1.17E-11 | 1.31E-52 | mr1991_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220360743 | 5.07E-08 | 1.57E-14 | mr1991_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |