\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220360743:

Variant ID: vg1220360743 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 20360743
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.87, T: 0.13, others allele: 0.00, population size: 46. )

Flanking Sequence (100 bp) in Reference Genome:


CCTCATGCCAAGTGTCCATTTGGATGACGGTTGGAGCGCCGGAAACGGTCATAACCGTCATTGGGAAGCAGTTATCTACCGAACTGGACTTGGGCCGGGG[T/C]
AAACGGCCTCTGCCAGGGTTTGGCCGAACTCAGGGGTTCGGCTGAACCCGGGACGGCTCCGTTCGCTCCGGTTTTCATCCTGGACACTCATTTTGGGCCC

Reverse complement sequence

GGGCCCAAAATGAGTGTCCAGGATGAAAACCGGAGCGAACGGAGCCGTCCCGGGTTCAGCCGAACCCCTGAGTTCGGCCAAACCCTGGCAGAGGCCGTTT[A/G]
CCCCGGCCCAAGTCCAGTTCGGTAGATAACTGCTTCCCAATGACGGTTATGACCGTTTCCGGCGCTCCAACCGTCATCCAAATGGACACTTGGCATGAGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 29.20% 21.30% 9.14% 40.33% NA
All Indica  2759 13.30% 24.10% 12.54% 50.09% NA
All Japonica  1512 61.20% 20.00% 1.85% 16.93% NA
Aus  269 15.60% 0.70% 15.24% 68.40% NA
Indica I  595 33.80% 37.30% 10.59% 18.32% NA
Indica II  465 11.00% 15.50% 11.40% 62.15% NA
Indica III  913 2.20% 20.50% 13.36% 63.96% NA
Indica Intermediate  786 12.10% 23.30% 13.74% 50.89% NA
Temperate Japonica  767 89.40% 5.10% 0.91% 4.56% NA
Tropical Japonica  504 23.40% 43.80% 3.77% 28.97% NA
Japonica Intermediate  241 50.20% 17.80% 0.83% 31.12% NA
VI/Aromatic  96 9.40% 18.80% 7.29% 64.58% NA
Intermediate  90 40.00% 24.40% 11.11% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1220360743 T -> C LOC_Os12g33750.1 upstream_gene_variant ; 4222.0bp to feature; MODIFIER silent_mutation Average:22.101; most accessible tissue: Minghui63 root, score: 35.002 N N N N
vg1220360743 T -> C LOC_Os12g33730.1 downstream_gene_variant ; 3731.0bp to feature; MODIFIER silent_mutation Average:22.101; most accessible tissue: Minghui63 root, score: 35.002 N N N N
vg1220360743 T -> C LOC_Os12g33740.1 downstream_gene_variant ; 1705.0bp to feature; MODIFIER silent_mutation Average:22.101; most accessible tissue: Minghui63 root, score: 35.002 N N N N
vg1220360743 T -> C LOC_Os12g33740-LOC_Os12g33750 intergenic_region ; MODIFIER silent_mutation Average:22.101; most accessible tissue: Minghui63 root, score: 35.002 N N N N
vg1220360743 T -> DEL N N silent_mutation Average:22.101; most accessible tissue: Minghui63 root, score: 35.002 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1220360743 1.64E-16 2.85E-85 mr1334 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220360743 5.95E-12 6.97E-24 mr1334 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220360743 4.35E-20 3.18E-97 mr1334_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220360743 3.47E-06 3.84E-08 mr1334_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220360743 3.50E-10 1.06E-26 mr1334_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220360743 1.17E-11 1.31E-52 mr1991_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220360743 5.07E-08 1.57E-14 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251