\
| Variant ID: vg1220338644 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 20338644 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GTTTGAGTGCACGGTTATGTCATTTGGACTCACCAATGCACCGGCTTTCTTCATGAACTTAATGAACAAAGTGTTTATGGAGTTTCTTGACAAGTTTGTC[A/G]
TGGTATTCATTGACGACATACTTATTTATTCAAAATCAGAAGAGGAACATGAGCAGCATCTCCGTCTTGTACTCGAGAAATTGAAGGAGCACCAGTTATA
TATAACTGGTGCTCCTTCAATTTCTCGAGTACAAGACGGAGATGCTGCTCATGTTCCTCTTCTGATTTTGAATAAATAAGTATGTCGTCAATGAATACCA[T/C]
GACAAACTTGTCAAGAAACTCCATAAACACTTTGTTCATTAAGTTCATGAAGAAAGCCGGTGCATTGGTGAGTCCAAATGACATAACCGTGCACTCAAAC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.70% | 0.20% | 4.99% | 16.17% | NA |
| All Indica | 2759 | 81.70% | 0.30% | 4.46% | 13.56% | NA |
| All Japonica | 1512 | 74.30% | 0.10% | 3.77% | 21.76% | NA |
| Aus | 269 | 68.80% | 0.00% | 17.84% | 13.38% | NA |
| Indica I | 595 | 85.20% | 0.30% | 1.85% | 12.61% | NA |
| Indica II | 465 | 76.10% | 0.20% | 6.24% | 17.42% | NA |
| Indica III | 913 | 83.00% | 0.00% | 5.04% | 11.94% | NA |
| Indica Intermediate | 786 | 80.90% | 0.50% | 4.71% | 13.87% | NA |
| Temperate Japonica | 767 | 97.30% | 0.00% | 0.13% | 2.61% | NA |
| Tropical Japonica | 504 | 37.50% | 0.40% | 9.72% | 52.38% | NA |
| Japonica Intermediate | 241 | 78.40% | 0.00% | 2.90% | 18.67% | NA |
| VI/Aromatic | 96 | 86.50% | 0.00% | 5.21% | 8.33% | NA |
| Intermediate | 90 | 77.80% | 0.00% | 3.33% | 18.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1220338644 | A -> DEL | LOC_Os12g33690.1 | N | frameshift_variant | Average:11.889; most accessible tissue: Callus, score: 16.536 | N | N | N | N |
| vg1220338644 | A -> G | LOC_Os12g33690.1 | missense_variant ; p.Met672Val; MODERATE | nonsynonymous_codon ; M672V | Average:11.889; most accessible tissue: Callus, score: 16.536 | unknown | unknown | TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1220338644 | NA | 2.22E-16 | mr1156 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220338644 | 4.95E-13 | 3.64E-97 | mr1334 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220338644 | 3.38E-09 | 1.86E-12 | mr1334 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220338644 | NA | 2.48E-16 | mr1334 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220338644 | NA | 8.63E-07 | mr1587 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220338644 | NA | 3.63E-20 | mr1588 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220338644 | 4.81E-13 | 2.93E-105 | mr1334_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220338644 | 4.78E-07 | 8.63E-11 | mr1334_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220338644 | NA | 1.34E-18 | mr1334_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220338644 | NA | 1.32E-14 | mr1790_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220338644 | NA | 2.16E-08 | mr1991_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |