\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220336453:

Variant ID: vg1220336453 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 20336453
Reference Allele: GAlternative Allele: C,T
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.61, G: 0.39, others allele: 0.00, population size: 74. )

Flanking Sequence (100 bp) in Reference Genome:


TTCAGTGTTTTAATCAAGATTAAGATAGTTGCACTTAAATTTATAAGAAAGATTAGTTTCCGAGCCATCTGTTTTCTTCCTTTCTCTTATTTCTACCTAT[G/C,T]
CTCGTCCAGATGGTGAAGACAAGGAATGATCCCCGTGACTCCAACGATGCCAGTGGCAGCGAAGAGCAGACAGATGGAGCTCATACCAGTGGTGCATCTG

Reverse complement sequence

CAGATGCACCACTGGTATGAGCTCCATCTGTCTGCTCTTCGCTGCCACTGGCATCGTTGGAGTCACGGGGATCATTCCTTGTCTTCACCATCTGGACGAG[C/G,A]
ATAGGTAGAAATAAGAGAAAGGAAGAAAACAGATGGCTCGGAAACTAATCTTTCTTATAAATTTAAGTGCAACTATCTTAATCTTGATTAAAACACTGAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.60% 4.40% 22.77% 36.16% T: 0.04%
All Indica  2759 20.20% 5.40% 26.93% 47.44% T: 0.04%
All Japonica  1512 70.60% 2.40% 5.22% 21.76% NA
Aus  269 20.10% 4.80% 68.77% 6.32% NA
Indica I  595 43.70% 5.40% 21.01% 29.92% NA
Indica II  465 23.00% 6.90% 31.18% 38.92% NA
Indica III  913 2.80% 4.10% 26.40% 66.70% NA
Indica Intermediate  786 20.90% 6.10% 29.52% 43.38% T: 0.13%
Temperate Japonica  767 94.90% 0.30% 1.43% 3.39% NA
Tropical Japonica  504 34.10% 6.30% 10.32% 49.21% NA
Japonica Intermediate  241 69.70% 0.80% 6.64% 22.82% NA
VI/Aromatic  96 12.50% 7.30% 46.88% 32.29% T: 1.04%
Intermediate  90 42.20% 5.60% 26.67% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1220336453 G -> C LOC_Os12g33690.1 upstream_gene_variant ; 10.0bp to feature; MODIFIER silent_mutation Average:11.311; most accessible tissue: Callus, score: 42.105 N N N N
vg1220336453 G -> C LOC_Os12g33680.1 downstream_gene_variant ; 3931.0bp to feature; MODIFIER silent_mutation Average:11.311; most accessible tissue: Callus, score: 42.105 N N N N
vg1220336453 G -> C LOC_Os12g33680-LOC_Os12g33690 intergenic_region ; MODIFIER silent_mutation Average:11.311; most accessible tissue: Callus, score: 42.105 N N N N
vg1220336453 G -> DEL N N silent_mutation Average:11.311; most accessible tissue: Callus, score: 42.105 N N N N
vg1220336453 G -> T LOC_Os12g33690.1 upstream_gene_variant ; 10.0bp to feature; MODIFIER silent_mutation Average:11.311; most accessible tissue: Callus, score: 42.105 N N N N
vg1220336453 G -> T LOC_Os12g33680.1 downstream_gene_variant ; 3931.0bp to feature; MODIFIER silent_mutation Average:11.311; most accessible tissue: Callus, score: 42.105 N N N N
vg1220336453 G -> T LOC_Os12g33680-LOC_Os12g33690 intergenic_region ; MODIFIER silent_mutation Average:11.311; most accessible tissue: Callus, score: 42.105 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1220336453 NA 1.02E-44 mr1016 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336453 NA 6.95E-37 mr1017 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336453 NA 5.01E-34 mr1055 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336453 NA 1.35E-41 mr1093 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336453 NA 2.48E-10 mr1093 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336453 NA 1.37E-06 mr1257 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336453 6.48E-21 3.93E-124 mr1334 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336453 2.08E-06 1.31E-19 mr1334 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336453 NA 1.75E-51 mr1490 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336453 NA 5.63E-08 mr1599 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336453 NA 2.67E-08 mr1603 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336453 NA 9.08E-36 mr1784 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336453 NA 4.99E-70 mr1019_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336453 NA 1.01E-37 mr1022_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336453 NA 2.03E-70 mr1023_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336453 NA 5.89E-50 mr1055_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336453 NA 3.36E-80 mr1132_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336453 6.67E-30 3.14E-149 mr1334_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336453 1.49E-06 1.67E-25 mr1334_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336453 NA 1.99E-62 mr1390_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336453 NA 7.42E-65 mr1490_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336453 3.63E-12 8.12E-66 mr1991_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336453 4.49E-07 4.17E-14 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251