\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220336402:

Variant ID: vg1220336402 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 20336402
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTCATGTGTGAGTGGTATGACAGCCTTAATTAGGAATTGCGTGCCTCTTTTTCAGTGTTTTAATCAAGATTAAGATAGTTGCACTTAAATTTATAAGAA[A/T]
GATTAGTTTCCGAGCCATCTGTTTTCTTCCTTTCTCTTATTTCTACCTATGCTCGTCCAGATGGTGAAGACAAGGAATGATCCCCGTGACTCCAACGATG

Reverse complement sequence

CATCGTTGGAGTCACGGGGATCATTCCTTGTCTTCACCATCTGGACGAGCATAGGTAGAAATAAGAGAAAGGAAGAAAACAGATGGCTCGGAAACTAATC[T/A]
TTCTTATAAATTTAAGTGCAACTATCTTAATCTTGATTAAAACACTGAAAAAGAGGCACGCAATTCCTAATTAAGGCTGTCATACCACTCACACATGAAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.40% 10.80% 9.78% 22.07% NA
All Indica  2759 49.50% 12.00% 13.08% 25.44% NA
All Japonica  1512 78.40% 0.20% 2.12% 19.31% NA
Aus  269 29.00% 59.10% 7.06% 4.83% NA
Indica I  595 65.90% 8.70% 13.11% 12.27% NA
Indica II  465 57.80% 16.80% 10.97% 14.41% NA
Indica III  913 32.10% 10.50% 15.55% 41.84% NA
Indica Intermediate  786 52.30% 13.40% 11.45% 22.90% NA
Temperate Japonica  767 96.20% 0.00% 0.91% 2.87% NA
Tropical Japonica  504 52.80% 0.60% 2.98% 43.65% NA
Japonica Intermediate  241 75.10% 0.00% 4.15% 20.75% NA
VI/Aromatic  96 28.10% 7.30% 41.67% 22.92% NA
Intermediate  90 62.20% 11.10% 11.11% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1220336402 A -> DEL N N silent_mutation Average:10.412; most accessible tissue: Callus, score: 24.523 N N N N
vg1220336402 A -> T LOC_Os12g33690.1 upstream_gene_variant ; 61.0bp to feature; MODIFIER silent_mutation Average:10.412; most accessible tissue: Callus, score: 24.523 N N N N
vg1220336402 A -> T LOC_Os12g33680.1 downstream_gene_variant ; 3880.0bp to feature; MODIFIER silent_mutation Average:10.412; most accessible tissue: Callus, score: 24.523 N N N N
vg1220336402 A -> T LOC_Os12g33680-LOC_Os12g33690 intergenic_region ; MODIFIER silent_mutation Average:10.412; most accessible tissue: Callus, score: 24.523 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1220336402 NA 3.30E-06 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336402 1.16E-07 1.16E-18 mr1317 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336402 2.19E-07 1.41E-17 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336402 NA 2.58E-11 mr1608 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336402 NA 2.29E-06 mr1608 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336402 3.16E-07 1.46E-09 mr1610 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336402 NA 1.34E-06 mr1610 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336402 NA 4.85E-09 mr1818 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336402 1.14E-06 1.23E-46 mr1855 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336402 NA 3.49E-27 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336402 NA 4.41E-16 mr1897 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336402 NA 6.71E-07 mr1914 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336402 NA 7.55E-11 mr1927 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336402 NA 3.47E-06 mr1927 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336402 NA 2.27E-07 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336402 NA 5.85E-06 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336402 NA 2.81E-18 mr1317_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336402 NA 6.78E-18 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336402 NA 9.96E-11 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336402 NA 4.50E-08 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336402 NA 5.55E-13 mr1610_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336402 NA 5.84E-10 mr1610_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336402 NA 3.51E-18 mr1818_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336402 NA 9.78E-15 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336402 NA 1.30E-48 mr1855_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336402 NA 1.94E-25 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336402 NA 1.67E-19 mr1897_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336402 NA 6.48E-14 mr1897_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336402 NA 1.28E-22 mr1914_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336402 NA 1.81E-20 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336402 NA 5.02E-24 mr1927_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336402 NA 5.72E-18 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251