Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220336338:

Variant ID: vg1220336338 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 20336338
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

TTAGTCTGTTTGCTTGCTAGTTTTTGTATTTAGGTTTGTTGCTTGTGGGTTAGTCGGCGGTCGATTTCATGTGTGAGTGGTATGACAGCCTTAATTAGGA[A/G]
TTGCGTGCCTCTTTTTCAGTGTTTTAATCAAGATTAAGATAGTTGCACTTAAATTTATAAGAAAGATTAGTTTCCGAGCCATCTGTTTTCTTCCTTTCTC

Reverse complement sequence

GAGAAAGGAAGAAAACAGATGGCTCGGAAACTAATCTTTCTTATAAATTTAAGTGCAACTATCTTAATCTTGATTAAAACACTGAAAAAGAGGCACGCAA[T/C]
TCCTAATTAAGGCTGTCATACCACTCACACATGAAATCGACCGCCGACTAACCCACAAGCAACAAACCTAAATACAAAAACTAGCAAGCAAACAGACTAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	45.70%	11.10%	3.70%	39.53%	NA
All Indica	2759	34.40%	12.30%	3.04%	50.31%	NA
All Japonica	1512	71.30%	0.30%	3.51%	24.87%	NA
Aus	269	24.50%	61.70%	5.58%	8.18%	NA
Indica I	595	55.30%	8.70%	3.03%	32.94%	NA
Indica II	465	35.90%	18.10%	1.94%	44.09%	NA
Indica III	913	16.90%	10.20%	3.72%	69.22%	NA
Indica Intermediate	786	38.00%	13.90%	2.93%	45.17%	NA
Temperate Japonica	767	95.00%	0.00%	0.39%	4.56%	NA
Tropical Japonica	504	35.50%	1.00%	8.93%	54.56%	NA
Japonica Intermediate	241	70.50%	0.00%	2.07%	27.39%	NA
VI/Aromatic	96	14.60%	7.30%	17.71%	60.42%	NA
Intermediate	90	56.70%	10.00%	6.67%	26.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1220336338	A -> DEL	N	N	silent_mutation	Average:11.831; most accessible tissue: Callus, score: 24.523	N	N	N	N
vg1220336338	A -> G	LOC_Os12g33690.1	upstream_gene_variant ; 125.0bp to feature; MODIFIER	silent_mutation	Average:11.831; most accessible tissue: Callus, score: 24.523	N	N	N	N
vg1220336338	A -> G	LOC_Os12g33680.1	downstream_gene_variant ; 3816.0bp to feature; MODIFIER	silent_mutation	Average:11.831; most accessible tissue: Callus, score: 24.523	N	N	N	N
vg1220336338	A -> G	LOC_Os12g33680-LOC_Os12g33690	intergenic_region ; MODIFIER	silent_mutation	Average:11.831; most accessible tissue: Callus, score: 24.523	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1220336338	1.35E-06	1.31E-14	mr1317	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336338	2.87E-08	4.51E-17	mr1317	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336338	NA	5.51E-06	mr1629	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336338	NA	2.42E-07	mr1649	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336338	NA	4.23E-09	mr1818	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336338	3.37E-06	7.78E-44	mr1855	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336338	9.77E-10	1.92E-32	mr1855	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336338	NA	2.88E-06	mr1914	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336338	NA	1.93E-06	mr1927	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336338	NA	6.77E-06	mr1255_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336338	1.34E-06	4.53E-19	mr1317_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336338	3.19E-06	1.54E-19	mr1317_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336338	NA	1.32E-12	mr1608_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336338	NA	3.98E-11	mr1608_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336338	NA	2.39E-15	mr1610_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336338	NA	2.33E-12	mr1610_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336338	4.02E-08	1.39E-22	mr1818_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336338	9.92E-08	1.29E-16	mr1818_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336338	4.38E-06	1.96E-48	mr1855_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336338	1.81E-06	2.41E-31	mr1855_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336338	2.77E-06	4.97E-19	mr1897_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336338	NA	5.05E-13	mr1897_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336338	3.02E-06	3.86E-23	mr1914_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336338	5.16E-06	8.43E-19	mr1914_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336338	2.39E-07	2.38E-24	mr1927_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336338	1.28E-06	5.18E-19	mr1927_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251