\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220336317:

Variant ID: vg1220336317 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 20336317
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


ACCCTTAGCTTTATCGTCTTCTTAGTCTGTTTGCTTGCTAGTTTTTGTATTTAGGTTTGTTGCTTGTGGGTTAGTCGGCGGTCGATTTCATGTGTGAGTG[G/A]
TATGACAGCCTTAATTAGGAATTGCGTGCCTCTTTTTCAGTGTTTTAATCAAGATTAAGATAGTTGCACTTAAATTTATAAGAAAGATTAGTTTCCGAGC

Reverse complement sequence

GCTCGGAAACTAATCTTTCTTATAAATTTAAGTGCAACTATCTTAATCTTGATTAAAACACTGAAAAAGAGGCACGCAATTCCTAATTAAGGCTGTCATA[C/T]
CACTCACACATGAAATCGACCGCCGACTAACCCACAAGCAACAAACCTAAATACAAAAACTAGCAAGCAAACAGACTAAGAAGACGATAAAGCTAAGGGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.10% 4.00% 8.48% 41.41% NA
All Indica  2759 34.70% 4.90% 9.39% 51.07% NA
All Japonica  1512 71.20% 0.10% 1.26% 27.45% NA
Aus  269 29.40% 17.50% 42.75% 10.41% NA
Indica I  595 55.60% 3.90% 6.72% 33.78% NA
Indica II  465 36.80% 6.70% 12.47% 44.09% NA
Indica III  913 17.10% 4.30% 8.21% 70.43% NA
Indica Intermediate  786 37.90% 5.30% 10.94% 45.80% NA
Temperate Japonica  767 95.00% 0.00% 0.26% 4.69% NA
Tropical Japonica  504 35.50% 0.20% 2.78% 61.51% NA
Japonica Intermediate  241 70.10% 0.00% 1.24% 28.63% NA
VI/Aromatic  96 14.60% 2.10% 5.21% 78.12% NA
Intermediate  90 57.80% 5.60% 3.33% 33.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1220336317 G -> DEL N N silent_mutation Average:13.747; most accessible tissue: Callus, score: 44.232 N N N N
vg1220336317 G -> A LOC_Os12g33690.1 upstream_gene_variant ; 146.0bp to feature; MODIFIER silent_mutation Average:13.747; most accessible tissue: Callus, score: 44.232 N N N N
vg1220336317 G -> A LOC_Os12g33680.1 downstream_gene_variant ; 3795.0bp to feature; MODIFIER silent_mutation Average:13.747; most accessible tissue: Callus, score: 44.232 N N N N
vg1220336317 G -> A LOC_Os12g33680-LOC_Os12g33690 intergenic_region ; MODIFIER silent_mutation Average:13.747; most accessible tissue: Callus, score: 44.232 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1220336317 1.90E-09 1.86E-18 mr1317 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336317 1.72E-10 8.31E-19 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336317 NA 3.88E-09 mr1608 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336317 2.37E-06 4.88E-08 mr1610 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336317 NA 3.99E-06 mr1610 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336317 NA 3.12E-06 mr1649 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336317 NA 4.39E-09 mr1818 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336317 NA 5.64E-06 mr1830 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336317 7.64E-10 3.49E-53 mr1855 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336317 2.98E-12 3.12E-36 mr1855 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336317 NA 1.27E-14 mr1897 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336317 NA 6.46E-06 mr1897 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336317 NA 7.10E-07 mr1914 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336317 NA 1.07E-11 mr1927 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336317 NA 8.45E-07 mr1927 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336317 NA 2.79E-07 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336317 NA 2.80E-06 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336317 NA 1.84E-06 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336317 5.04E-07 7.08E-21 mr1317_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336317 2.12E-07 3.95E-20 mr1317_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336317 8.71E-06 1.09E-14 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336317 NA 5.06E-12 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336317 NA 1.73E-17 mr1610_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336317 NA 2.42E-12 mr1610_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336317 1.58E-06 3.80E-22 mr1818_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336317 1.92E-07 3.08E-16 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336317 3.93E-10 4.85E-59 mr1855_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336317 4.53E-11 5.28E-36 mr1855_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336317 2.99E-06 1.27E-21 mr1897_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336317 NA 1.66E-13 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336317 3.14E-06 4.63E-24 mr1914_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336317 5.13E-07 8.04E-21 mr1914_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336317 3.03E-07 6.89E-28 mr1927_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336317 8.33E-07 2.79E-20 mr1927_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251