\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220336261:

Variant ID: vg1220336261 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 20336261
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:


TTAGAAGTCAGACCTGTTCTTCGATCGCAAGCGCTGCTCCGAGCTTTAGAGTCGCCACCCTTAGCTTTATCGTCTTCTTAGTCTGTTTGCTTGCTAGTTT[T/C]
TGTATTTAGGTTTGTTGCTTGTGGGTTAGTCGGCGGTCGATTTCATGTGTGAGTGGTATGACAGCCTTAATTAGGAATTGCGTGCCTCTTTTTCAGTGTT

Reverse complement sequence

AACACTGAAAAAGAGGCACGCAATTCCTAATTAAGGCTGTCATACCACTCACACATGAAATCGACCGCCGACTAACCCACAAGCAACAAACCTAAATACA[A/G]
AAACTAGCAAGCAAACAGACTAAGAAGACGATAAAGCTAAGGGTGGCGACTCTAAAGCTCGGAGCAGCGCTTGCGATCGAAGAACAGGTCTGACTTCTAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.00% 7.70% 6.75% 32.59% NA
All Indica  2759 34.20% 8.30% 7.14% 50.34% NA
All Japonica  1512 92.00% 0.70% 0.73% 6.55% NA
Aus  269 35.70% 21.90% 34.57% 7.81% NA
Indica I  595 55.00% 5.70% 5.55% 33.78% NA
Indica II  465 36.10% 10.80% 9.25% 43.87% NA
Indica III  913 17.30% 6.70% 6.90% 69.11% NA
Indica Intermediate  786 37.00% 10.70% 7.38% 44.91% NA
Temperate Japonica  767 93.90% 0.70% 0.78% 4.69% NA
Tropical Japonica  504 88.30% 0.20% 0.60% 10.91% NA
Japonica Intermediate  241 93.80% 2.10% 0.83% 3.32% NA
VI/Aromatic  96 17.70% 56.20% 13.54% 12.50% NA
Intermediate  90 62.20% 11.10% 5.56% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1220336261 T -> C LOC_Os12g33690.1 upstream_gene_variant ; 202.0bp to feature; MODIFIER silent_mutation Average:14.241; most accessible tissue: Callus, score: 44.232 N N N N
vg1220336261 T -> C LOC_Os12g33680.1 downstream_gene_variant ; 3739.0bp to feature; MODIFIER silent_mutation Average:14.241; most accessible tissue: Callus, score: 44.232 N N N N
vg1220336261 T -> C LOC_Os12g33680-LOC_Os12g33690 intergenic_region ; MODIFIER silent_mutation Average:14.241; most accessible tissue: Callus, score: 44.232 N N N N
vg1220336261 T -> DEL N N silent_mutation Average:14.241; most accessible tissue: Callus, score: 44.232 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1220336261 1.46E-07 4.46E-17 mr1317 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336261 5.53E-11 4.66E-20 mr1317 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336261 NA 2.81E-09 mr1608 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336261 NA 2.94E-06 mr1608 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336261 NA 1.13E-06 mr1610 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336261 7.32E-06 8.28E-10 mr1818 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336261 NA 1.93E-47 mr1855 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336261 4.99E-08 1.91E-32 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336261 NA 2.30E-12 mr1897 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336261 NA 1.74E-06 mr1897 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336261 NA 4.05E-07 mr1914 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336261 NA 6.08E-10 mr1927 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336261 NA 6.75E-07 mr1927 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336261 NA 6.18E-06 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336261 NA 2.98E-18 mr1317_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336261 3.40E-06 2.11E-19 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336261 NA 3.63E-12 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336261 NA 7.20E-10 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336261 NA 4.14E-14 mr1610_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336261 NA 3.09E-11 mr1610_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336261 NA 1.20E-18 mr1818_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336261 NA 3.86E-14 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336261 5.85E-06 1.73E-50 mr1855_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336261 1.19E-09 2.76E-33 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336261 NA 5.17E-18 mr1897_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336261 NA 1.54E-12 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336261 NA 1.74E-21 mr1914_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336261 NA 9.11E-19 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336261 NA 8.39E-23 mr1927_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336261 NA 3.45E-18 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251