Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220336261:

Variant ID: vg1220336261 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 20336261
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:

TTAGAAGTCAGACCTGTTCTTCGATCGCAAGCGCTGCTCCGAGCTTTAGAGTCGCCACCCTTAGCTTTATCGTCTTCTTAGTCTGTTTGCTTGCTAGTTT[T/C]
TGTATTTAGGTTTGTTGCTTGTGGGTTAGTCGGCGGTCGATTTCATGTGTGAGTGGTATGACAGCCTTAATTAGGAATTGCGTGCCTCTTTTTCAGTGTT

Reverse complement sequence

AACACTGAAAAAGAGGCACGCAATTCCTAATTAAGGCTGTCATACCACTCACACATGAAATCGACCGCCGACTAACCCACAAGCAACAAACCTAAATACA[A/G]
AAACTAGCAAGCAAACAGACTAAGAAGACGATAAAGCTAAGGGTGGCGACTCTAAAGCTCGGAGCAGCGCTTGCGATCGAAGAACAGGTCTGACTTCTAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.00%	7.70%	6.75%	32.59%	NA
All Indica	2759	34.20%	8.30%	7.14%	50.34%	NA
All Japonica	1512	92.00%	0.70%	0.73%	6.55%	NA
Aus	269	35.70%	21.90%	34.57%	7.81%	NA
Indica I	595	55.00%	5.70%	5.55%	33.78%	NA
Indica II	465	36.10%	10.80%	9.25%	43.87%	NA
Indica III	913	17.30%	6.70%	6.90%	69.11%	NA
Indica Intermediate	786	37.00%	10.70%	7.38%	44.91%	NA
Temperate Japonica	767	93.90%	0.70%	0.78%	4.69%	NA
Tropical Japonica	504	88.30%	0.20%	0.60%	10.91%	NA
Japonica Intermediate	241	93.80%	2.10%	0.83%	3.32%	NA
VI/Aromatic	96	17.70%	56.20%	13.54%	12.50%	NA
Intermediate	90	62.20%	11.10%	5.56%	21.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1220336261	T -> C	LOC_Os12g33690.1	upstream_gene_variant ; 202.0bp to feature; MODIFIER	silent_mutation	Average:14.241; most accessible tissue: Callus, score: 44.232	N	N	N	N
vg1220336261	T -> C	LOC_Os12g33680.1	downstream_gene_variant ; 3739.0bp to feature; MODIFIER	silent_mutation	Average:14.241; most accessible tissue: Callus, score: 44.232	N	N	N	N
vg1220336261	T -> C	LOC_Os12g33680-LOC_Os12g33690	intergenic_region ; MODIFIER	silent_mutation	Average:14.241; most accessible tissue: Callus, score: 44.232	N	N	N	N
vg1220336261	T -> DEL	N	N	silent_mutation	Average:14.241; most accessible tissue: Callus, score: 44.232	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1220336261	1.46E-07	4.46E-17	mr1317	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336261	5.53E-11	4.66E-20	mr1317	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336261	NA	2.81E-09	mr1608	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336261	NA	2.94E-06	mr1608	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336261	NA	1.13E-06	mr1610	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336261	7.32E-06	8.28E-10	mr1818	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336261	NA	1.93E-47	mr1855	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336261	4.99E-08	1.91E-32	mr1855	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336261	NA	2.30E-12	mr1897	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336261	NA	1.74E-06	mr1897	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336261	NA	4.05E-07	mr1914	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336261	NA	6.08E-10	mr1927	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336261	NA	6.75E-07	mr1927	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336261	NA	6.18E-06	mr1255_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336261	NA	2.98E-18	mr1317_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336261	3.40E-06	2.11E-19	mr1317_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336261	NA	3.63E-12	mr1608_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336261	NA	7.20E-10	mr1608_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336261	NA	4.14E-14	mr1610_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336261	NA	3.09E-11	mr1610_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336261	NA	1.20E-18	mr1818_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336261	NA	3.86E-14	mr1818_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336261	5.85E-06	1.73E-50	mr1855_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336261	1.19E-09	2.76E-33	mr1855_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336261	NA	5.17E-18	mr1897_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336261	NA	1.54E-12	mr1897_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336261	NA	1.74E-21	mr1914_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336261	NA	9.11E-19	mr1914_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336261	NA	8.39E-23	mr1927_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336261	NA	3.45E-18	mr1927_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251