\
| Variant ID: vg1220284744 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 20284744 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TGAGTACTTCTTTGCTGGCATCATTGAGATGAAGTTTTCAGATTTGATATCAGTTCAGTAGCAAGAAGGGGAATCGGCTATGGAATATATTCAAAGATTT[T/C]
GTGATGTCCGCAGCCGATGTTATAGTTTGAGCCTAAGCGATGAGCCGCTAGCAGATCTTGCATTTCAAGGATTGTCAGTACCTATCAGAGATAGATTCTT
AAGAATCTATCTCTGATAGGTACTGACAATCCTTGAAATGCAAGATCTGCTAGCGGCTCATCGCTTAGGCTCAAACTATAACATCGGCTGCGGACATCAC[A/G]
AAATCTTTGAATATATTCCATAGCCGATTCCCCTTCTTGCTACTGAACTGATATCAAATCTGAAAACTTCATCTCAATGATGCCAGCAAAGAAGTACTCA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 37.20% | 1.10% | 45.85% | 15.89% | NA |
| All Indica | 2759 | 20.60% | 1.40% | 66.04% | 11.96% | NA |
| All Japonica | 1512 | 70.80% | 0.40% | 5.22% | 23.54% | NA |
| Aus | 269 | 23.00% | 2.20% | 63.94% | 10.78% | NA |
| Indica I | 595 | 44.90% | 0.70% | 42.18% | 12.27% | NA |
| Indica II | 465 | 24.10% | 0.90% | 57.42% | 17.63% | NA |
| Indica III | 913 | 2.50% | 1.90% | 89.27% | 6.35% | NA |
| Indica Intermediate | 786 | 21.10% | 1.80% | 62.21% | 14.89% | NA |
| Temperate Japonica | 767 | 95.20% | 0.00% | 0.26% | 4.56% | NA |
| Tropical Japonica | 504 | 33.90% | 1.20% | 14.09% | 50.79% | NA |
| Japonica Intermediate | 241 | 70.50% | 0.00% | 2.49% | 26.97% | NA |
| VI/Aromatic | 96 | 13.50% | 0.00% | 64.58% | 21.88% | NA |
| Intermediate | 90 | 47.80% | 0.00% | 35.56% | 16.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1220284744 | T -> C | LOC_Os12g33590.1 | upstream_gene_variant ; 3142.0bp to feature; MODIFIER | silent_mutation | Average:22.267; most accessible tissue: Callus, score: 53.565 | N | N | N | N |
| vg1220284744 | T -> C | LOC_Os12g33580.1 | downstream_gene_variant ; 40.0bp to feature; MODIFIER | silent_mutation | Average:22.267; most accessible tissue: Callus, score: 53.565 | N | N | N | N |
| vg1220284744 | T -> C | LOC_Os12g33580-LOC_Os12g33590 | intergenic_region ; MODIFIER | silent_mutation | Average:22.267; most accessible tissue: Callus, score: 53.565 | N | N | N | N |
| vg1220284744 | T -> DEL | N | N | silent_mutation | Average:22.267; most accessible tissue: Callus, score: 53.565 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1220284744 | 4.75E-06 | 4.75E-06 | mr1122 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220284744 | NA | 2.05E-07 | mr1229 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220284744 | 7.20E-10 | NA | mr1334 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220284744 | NA | 5.41E-06 | mr1334 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220284744 | 4.02E-07 | 8.46E-20 | mr1334 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220284744 | NA | 5.22E-06 | mr1338 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220284744 | NA | 4.67E-07 | mr1403 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220284744 | NA | 3.07E-11 | mr1539 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220284744 | 8.47E-11 | NA | mr1334_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220284744 | 1.52E-06 | 1.02E-24 | mr1334_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220284744 | 6.14E-06 | NA | mr1991_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220284744 | 8.93E-07 | 4.01E-13 | mr1991_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |