\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220284744:

Variant ID: vg1220284744 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 20284744
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGAGTACTTCTTTGCTGGCATCATTGAGATGAAGTTTTCAGATTTGATATCAGTTCAGTAGCAAGAAGGGGAATCGGCTATGGAATATATTCAAAGATTT[T/C]
GTGATGTCCGCAGCCGATGTTATAGTTTGAGCCTAAGCGATGAGCCGCTAGCAGATCTTGCATTTCAAGGATTGTCAGTACCTATCAGAGATAGATTCTT

Reverse complement sequence

AAGAATCTATCTCTGATAGGTACTGACAATCCTTGAAATGCAAGATCTGCTAGCGGCTCATCGCTTAGGCTCAAACTATAACATCGGCTGCGGACATCAC[A/G]
AAATCTTTGAATATATTCCATAGCCGATTCCCCTTCTTGCTACTGAACTGATATCAAATCTGAAAACTTCATCTCAATGATGCCAGCAAAGAAGTACTCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.20% 1.10% 45.85% 15.89% NA
All Indica  2759 20.60% 1.40% 66.04% 11.96% NA
All Japonica  1512 70.80% 0.40% 5.22% 23.54% NA
Aus  269 23.00% 2.20% 63.94% 10.78% NA
Indica I  595 44.90% 0.70% 42.18% 12.27% NA
Indica II  465 24.10% 0.90% 57.42% 17.63% NA
Indica III  913 2.50% 1.90% 89.27% 6.35% NA
Indica Intermediate  786 21.10% 1.80% 62.21% 14.89% NA
Temperate Japonica  767 95.20% 0.00% 0.26% 4.56% NA
Tropical Japonica  504 33.90% 1.20% 14.09% 50.79% NA
Japonica Intermediate  241 70.50% 0.00% 2.49% 26.97% NA
VI/Aromatic  96 13.50% 0.00% 64.58% 21.88% NA
Intermediate  90 47.80% 0.00% 35.56% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1220284744 T -> C LOC_Os12g33590.1 upstream_gene_variant ; 3142.0bp to feature; MODIFIER silent_mutation Average:22.267; most accessible tissue: Callus, score: 53.565 N N N N
vg1220284744 T -> C LOC_Os12g33580.1 downstream_gene_variant ; 40.0bp to feature; MODIFIER silent_mutation Average:22.267; most accessible tissue: Callus, score: 53.565 N N N N
vg1220284744 T -> C LOC_Os12g33580-LOC_Os12g33590 intergenic_region ; MODIFIER silent_mutation Average:22.267; most accessible tissue: Callus, score: 53.565 N N N N
vg1220284744 T -> DEL N N silent_mutation Average:22.267; most accessible tissue: Callus, score: 53.565 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1220284744 4.75E-06 4.75E-06 mr1122 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220284744 NA 2.05E-07 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220284744 7.20E-10 NA mr1334 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220284744 NA 5.41E-06 mr1334 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220284744 4.02E-07 8.46E-20 mr1334 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220284744 NA 5.22E-06 mr1338 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220284744 NA 4.67E-07 mr1403 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220284744 NA 3.07E-11 mr1539 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220284744 8.47E-11 NA mr1334_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220284744 1.52E-06 1.02E-24 mr1334_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220284744 6.14E-06 NA mr1991_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220284744 8.93E-07 4.01E-13 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251