Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220284744:

Variant ID: vg1220284744 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 20284744
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGAGTACTTCTTTGCTGGCATCATTGAGATGAAGTTTTCAGATTTGATATCAGTTCAGTAGCAAGAAGGGGAATCGGCTATGGAATATATTCAAAGATTT[T/C]
GTGATGTCCGCAGCCGATGTTATAGTTTGAGCCTAAGCGATGAGCCGCTAGCAGATCTTGCATTTCAAGGATTGTCAGTACCTATCAGAGATAGATTCTT

Reverse complement sequence

AAGAATCTATCTCTGATAGGTACTGACAATCCTTGAAATGCAAGATCTGCTAGCGGCTCATCGCTTAGGCTCAAACTATAACATCGGCTGCGGACATCAC[A/G]
AAATCTTTGAATATATTCCATAGCCGATTCCCCTTCTTGCTACTGAACTGATATCAAATCTGAAAACTTCATCTCAATGATGCCAGCAAAGAAGTACTCA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	37.20%	1.10%	45.85%	15.89%	NA
All Indica	2759	20.60%	1.40%	66.04%	11.96%	NA
All Japonica	1512	70.80%	0.40%	5.22%	23.54%	NA
Aus	269	23.00%	2.20%	63.94%	10.78%	NA
Indica I	595	44.90%	0.70%	42.18%	12.27%	NA
Indica II	465	24.10%	0.90%	57.42%	17.63%	NA
Indica III	913	2.50%	1.90%	89.27%	6.35%	NA
Indica Intermediate	786	21.10%	1.80%	62.21%	14.89%	NA
Temperate Japonica	767	95.20%	0.00%	0.26%	4.56%	NA
Tropical Japonica	504	33.90%	1.20%	14.09%	50.79%	NA
Japonica Intermediate	241	70.50%	0.00%	2.49%	26.97%	NA
VI/Aromatic	96	13.50%	0.00%	64.58%	21.88%	NA
Intermediate	90	47.80%	0.00%	35.56%	16.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1220284744	T -> C	LOC_Os12g33590.1	upstream_gene_variant ; 3142.0bp to feature; MODIFIER	silent_mutation	Average:22.267; most accessible tissue: Callus, score: 53.565	N	N	N	N
vg1220284744	T -> C	LOC_Os12g33580.1	downstream_gene_variant ; 40.0bp to feature; MODIFIER	silent_mutation	Average:22.267; most accessible tissue: Callus, score: 53.565	N	N	N	N
vg1220284744	T -> C	LOC_Os12g33580-LOC_Os12g33590	intergenic_region ; MODIFIER	silent_mutation	Average:22.267; most accessible tissue: Callus, score: 53.565	N	N	N	N
vg1220284744	T -> DEL	N	N	silent_mutation	Average:22.267; most accessible tissue: Callus, score: 53.565	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1220284744	4.75E-06	4.75E-06	mr1122	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220284744	NA	2.05E-07	mr1229	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220284744	7.20E-10	NA	mr1334	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220284744	NA	5.41E-06	mr1334	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220284744	4.02E-07	8.46E-20	mr1334	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220284744	NA	5.22E-06	mr1338	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220284744	NA	4.67E-07	mr1403	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220284744	NA	3.07E-11	mr1539	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220284744	8.47E-11	NA	mr1334_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220284744	1.52E-06	1.02E-24	mr1334_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220284744	6.14E-06	NA	mr1991_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220284744	8.93E-07	4.01E-13	mr1991_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251