\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220271826:

Variant ID: vg1220271826 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 20271826
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCCCCAGAAAAGCTTCGCAAGCATGGATGAAGTTGGCGATGTGGACTATGGAATTGGGATTTAGGTGATGCAAGCTAATCCCATAGAAATCCAAAATTCC[C/T]
CGGAAGAAATTTGAGGTCGGAAGAGAAAACCCGCAATAAAAGAAATGGGAGAATACCACCACCTCGTGTGTGTCGAGAGTCGGAAACATTTCACCGTACG

Reverse complement sequence

CGTACGGTGAAATGTTTCCGACTCTCGACACACACGAGGTGGTGGTATTCTCCCATTTCTTTTATTGCGGGTTTTCTCTTCCGACCTCAAATTTCTTCCG[G/A]
GGAATTTTGGATTTCTATGGGATTAGCTTGCATCACCTAAATCCCAATTCCATAGTCCACATCGCCAACTTCATCCATGCTTGCGAAGCTTTTCTGGGGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.80% 0.40% 12.02% 35.80% NA
All Indica  2759 40.60% 0.50% 16.20% 42.66% NA
All Japonica  1512 72.70% 0.00% 1.79% 25.53% NA
Aus  269 34.60% 1.10% 28.62% 35.69% NA
Indica I  595 56.00% 1.30% 22.18% 20.50% NA
Indica II  465 31.40% 0.00% 9.25% 59.35% NA
Indica III  913 31.70% 0.70% 17.09% 50.60% NA
Indica Intermediate  786 44.90% 0.00% 14.76% 40.33% NA
Temperate Japonica  767 95.40% 0.00% 0.26% 4.30% NA
Tropical Japonica  504 37.30% 0.00% 4.56% 58.13% NA
Japonica Intermediate  241 74.30% 0.00% 0.83% 24.90% NA
VI/Aromatic  96 80.20% 2.10% 11.46% 6.25% NA
Intermediate  90 62.20% 1.10% 6.67% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1220271826 C -> DEL LOC_Os12g33560.1 N frameshift_variant Average:15.491; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N
vg1220271826 C -> T LOC_Os12g33560.1 synonymous_variant ; p.Arg75Arg; LOW synonymous_codon Average:15.491; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N
vg1220271826 C -> T LOC_Os12g33560.1 synonymous_variant ; p.Arg75Arg; LOW nonsynonymous_codon ; R75Q Average:15.491; most accessible tissue: Zhenshan97 panicle, score: 36.038 unknown unknown TOLERATED 0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1220271826 NA 1.41E-06 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220271826 NA 9.53E-08 mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220271826 NA 1.60E-07 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220271826 NA 1.37E-07 mr1057_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220271826 4.95E-06 7.75E-08 mr1115_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220271826 NA 1.11E-06 mr1164_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220271826 3.78E-06 1.04E-06 mr1209_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220271826 NA 9.77E-07 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220271826 NA 1.33E-07 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220271826 NA 4.83E-06 mr1376_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220271826 NA 7.23E-06 mr1422_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220271826 NA 8.63E-08 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220271826 NA 5.47E-06 mr1431_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220271826 5.70E-06 5.67E-06 mr1523_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220271826 NA 5.82E-07 mr1611_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220271826 NA 4.88E-06 mr1707_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220271826 NA 5.93E-06 mr1743_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220271826 NA 6.51E-06 mr1820_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220271826 NA 5.34E-06 mr1820_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220271826 NA 1.19E-08 mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220271826 NA 3.83E-07 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251