Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1220263690:

Variant ID: vg1220263690 (JBrowse)	Variation Type: INDEL
Chromosome: chr12	Position: 20263690
Reference Allele: TGA	Alternative Allele: CGA,T
Primary Allele: TGA	Secondary Allele: CGA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACGTATCGGCAACTTTTCAGGTTGTAAGCACAGTCCTGGTTGTTGAGCGTGAAGAAGAAGGCCATGTTCAAAAAGTCCAACGACCAATCTACTTCGTTAG[TGA/CGA,T]
GGTTTTGGCCGACTCCAAGACAAGATATCCCTAGGTTCAAAAGCTATTATATGGTGTTTTAATTACCGTCAGGAAATTATCTCACTACTTCCAAGGTCAC

Reverse complement sequence

GTGACCTTGGAAGTAGTGAGATAATTTCCTGACGGTAATTAAAACACCATATAATAGCTTTTGAACCTAGGGATATCTTGTCTTGGAGTCGGCCAAAACC[TCA/TCG,A]
CTAACGAAGTAGATTGGTCGTTGGACTTTTTGAACATGGCCTTCTTCTTCACGCTCAACAACCAGGACTGTGCTTACAACCTGAAAAGTTGCCGATACGT

Allele Frequencies:

Populations	Population Size	Frequency of TGA(primary allele)	Frequency of CGA(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	37.30%	1.20%	10.98%	50.49%	T: 0.02%
All Indica	2759	20.00%	1.60%	15.84%	62.49%	NA
All Japonica	1512	72.40%	0.50%	3.70%	23.41%	NA
Aus	269	21.60%	1.10%	5.58%	71.38%	T: 0.37%
Indica I	595	41.00%	1.50%	4.87%	52.61%	NA
Indica II	465	23.40%	0.40%	20.65%	55.48%	NA
Indica III	913	3.70%	2.60%	19.06%	74.59%	NA
Indica Intermediate	786	21.10%	1.30%	17.56%	60.05%	NA
Temperate Japonica	767	94.90%	0.00%	0.52%	4.56%	NA
Tropical Japonica	504	38.50%	1.00%	7.94%	52.58%	NA
Japonica Intermediate	241	71.40%	1.20%	4.98%	22.41%	NA
VI/Aromatic	96	12.50%	1.00%	6.25%	80.21%	NA
Intermediate	90	48.90%	2.20%	5.56%	43.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1220263690	TGA -> DEL	N	N	silent_mutation	Average:7.14; most accessible tissue: Callus, score: 27.199	N	N	N	N
vg1220263690	TGA -> CGA	LOC_Os12g33530.1	downstream_gene_variant ; 312.0bp to feature; MODIFIER	silent_mutation	Average:7.14; most accessible tissue: Callus, score: 27.199	N	N	N	N
vg1220263690	TGA -> CGA	LOC_Os12g33540.1	downstream_gene_variant ; 1118.0bp to feature; MODIFIER	silent_mutation	Average:7.14; most accessible tissue: Callus, score: 27.199	N	N	N	N
vg1220263690	TGA -> CGA	LOC_Os12g33550.1	downstream_gene_variant ; 2299.0bp to feature; MODIFIER	silent_mutation	Average:7.14; most accessible tissue: Callus, score: 27.199	N	N	N	N
vg1220263690	TGA -> CGA	LOC_Os12g33530-LOC_Os12g33540	intergenic_region ; MODIFIER	silent_mutation	Average:7.14; most accessible tissue: Callus, score: 27.199	N	N	N	N
vg1220263690	TGA -> T	LOC_Os12g33530.1	downstream_gene_variant ; 313.0bp to feature; MODIFIER	silent_mutation	Average:7.14; most accessible tissue: Callus, score: 27.199	N	N	N	N
vg1220263690	TGA -> T	LOC_Os12g33540.1	downstream_gene_variant ; 1117.0bp to feature; MODIFIER	silent_mutation	Average:7.14; most accessible tissue: Callus, score: 27.199	N	N	N	N
vg1220263690	TGA -> T	LOC_Os12g33550.1	downstream_gene_variant ; 2298.0bp to feature; MODIFIER	silent_mutation	Average:7.14; most accessible tissue: Callus, score: 27.199	N	N	N	N
vg1220263690	TGA -> T	LOC_Os12g33530-LOC_Os12g33540	intergenic_region ; MODIFIER	silent_mutation	Average:7.14; most accessible tissue: Callus, score: 27.199	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1220263690	NA	6.81E-07	mr1020_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220263690	3.75E-06	3.75E-06	mr1333_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220263690	NA	1.48E-06	mr1686_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220263690	NA	3.80E-11	mr1722_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220263690	NA	9.44E-11	mr1893_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251