Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220251034:

Variant ID: vg1220251034 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 20251034
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTCAGTGGAGTATAGCATTGCTACACTCCTCCGTAAGCTTGACCATCTCCATGGTAGGCAGTGGCCTCTTGTTGTTCAGGATGTCTTTGAGATAGCGGGC[G/A]
TATATTGGTACCCGCATTGCATCCACCAACAGGATGTTGATGTGGATCTTCTGGATGACATCCATGAACCGAGCGAATTGCTAGTCCACGGAAGGCTTCT

Reverse complement sequence

AGAAGCCTTCCGTGGACTAGCAATTCGCTCGGTTCATGGATGTCATCCAGAAGATCCACATCAACATCCTGTTGGTGGATGCAATGCGGGTACCAATATA[C/T]
GCCCGCTATCTCAAAGACATCCTGAACAACAAGAGGCCACTGCCTACCATGGAGATGGTCAAGCTTACGGAGGAGTGTAGCAATGCTATACTCCACTGAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	33.60%	27.00%	1.27%	38.21%	NA
All Indica	2759	15.40%	43.20%	1.49%	39.94%	NA
All Japonica	1512	70.40%	0.60%	0.40%	28.64%	NA
Aus	269	15.20%	19.00%	4.09%	61.71%	NA
Indica I	595	34.60%	49.70%	0.84%	14.79%	NA
Indica II	465	15.70%	69.70%	0.86%	13.76%	NA
Indica III	913	3.50%	24.30%	1.86%	70.32%	NA
Indica Intermediate	786	14.40%	44.50%	1.91%	39.19%	NA
Temperate Japonica	767	95.40%	0.10%	0.39%	4.04%	NA
Tropical Japonica	504	32.50%	1.20%	0.40%	65.87%	NA
Japonica Intermediate	241	69.70%	0.80%	0.41%	29.05%	NA
VI/Aromatic	96	14.60%	5.20%	0.00%	80.21%	NA
Intermediate	90	47.80%	18.90%	2.22%	31.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1220251034	G -> DEL	N	N	silent_mutation	Average:24.449; most accessible tissue: Callus, score: 59.152	N	N	N	N
vg1220251034	G -> A	LOC_Os12g33510.1	upstream_gene_variant ; 1591.0bp to feature; MODIFIER	silent_mutation	Average:24.449; most accessible tissue: Callus, score: 59.152	N	N	N	N
vg1220251034	G -> A	LOC_Os12g33520.1	downstream_gene_variant ; 81.0bp to feature; MODIFIER	silent_mutation	Average:24.449; most accessible tissue: Callus, score: 59.152	N	N	N	N
vg1220251034	G -> A	LOC_Os12g33510-LOC_Os12g33520	intergenic_region ; MODIFIER	silent_mutation	Average:24.449; most accessible tissue: Callus, score: 59.152	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1220251034	3.91E-06	3.83E-06	mr1018	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220251034	9.37E-08	NA	mr1132	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220251034	1.86E-17	1.05E-106	mr1334	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220251034	1.07E-10	1.74E-14	mr1334	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220251034	NA	3.56E-14	mr1334	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220251034	3.61E-07	3.39E-07	mr1489	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220251034	NA	1.57E-12	mr1248_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220251034	NA	2.09E-06	mr1248_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220251034	1.40E-14	1.61E-108	mr1334_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220251034	NA	3.00E-08	mr1334_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220251034	NA	2.48E-17	mr1334_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220251034	2.72E-06	4.20E-53	mr1991_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220251034	NA	4.82E-10	mr1991_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251