\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220251034:

Variant ID: vg1220251034 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 20251034
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTCAGTGGAGTATAGCATTGCTACACTCCTCCGTAAGCTTGACCATCTCCATGGTAGGCAGTGGCCTCTTGTTGTTCAGGATGTCTTTGAGATAGCGGGC[G/A]
TATATTGGTACCCGCATTGCATCCACCAACAGGATGTTGATGTGGATCTTCTGGATGACATCCATGAACCGAGCGAATTGCTAGTCCACGGAAGGCTTCT

Reverse complement sequence

AGAAGCCTTCCGTGGACTAGCAATTCGCTCGGTTCATGGATGTCATCCAGAAGATCCACATCAACATCCTGTTGGTGGATGCAATGCGGGTACCAATATA[C/T]
GCCCGCTATCTCAAAGACATCCTGAACAACAAGAGGCCACTGCCTACCATGGAGATGGTCAAGCTTACGGAGGAGTGTAGCAATGCTATACTCCACTGAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.60% 27.00% 1.27% 38.21% NA
All Indica  2759 15.40% 43.20% 1.49% 39.94% NA
All Japonica  1512 70.40% 0.60% 0.40% 28.64% NA
Aus  269 15.20% 19.00% 4.09% 61.71% NA
Indica I  595 34.60% 49.70% 0.84% 14.79% NA
Indica II  465 15.70% 69.70% 0.86% 13.76% NA
Indica III  913 3.50% 24.30% 1.86% 70.32% NA
Indica Intermediate  786 14.40% 44.50% 1.91% 39.19% NA
Temperate Japonica  767 95.40% 0.10% 0.39% 4.04% NA
Tropical Japonica  504 32.50% 1.20% 0.40% 65.87% NA
Japonica Intermediate  241 69.70% 0.80% 0.41% 29.05% NA
VI/Aromatic  96 14.60% 5.20% 0.00% 80.21% NA
Intermediate  90 47.80% 18.90% 2.22% 31.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1220251034 G -> DEL N N silent_mutation Average:24.449; most accessible tissue: Callus, score: 59.152 N N N N
vg1220251034 G -> A LOC_Os12g33510.1 upstream_gene_variant ; 1591.0bp to feature; MODIFIER silent_mutation Average:24.449; most accessible tissue: Callus, score: 59.152 N N N N
vg1220251034 G -> A LOC_Os12g33520.1 downstream_gene_variant ; 81.0bp to feature; MODIFIER silent_mutation Average:24.449; most accessible tissue: Callus, score: 59.152 N N N N
vg1220251034 G -> A LOC_Os12g33510-LOC_Os12g33520 intergenic_region ; MODIFIER silent_mutation Average:24.449; most accessible tissue: Callus, score: 59.152 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1220251034 3.91E-06 3.83E-06 mr1018 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220251034 9.37E-08 NA mr1132 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220251034 1.86E-17 1.05E-106 mr1334 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220251034 1.07E-10 1.74E-14 mr1334 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220251034 NA 3.56E-14 mr1334 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220251034 3.61E-07 3.39E-07 mr1489 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220251034 NA 1.57E-12 mr1248_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220251034 NA 2.09E-06 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220251034 1.40E-14 1.61E-108 mr1334_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220251034 NA 3.00E-08 mr1334_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220251034 NA 2.48E-17 mr1334_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220251034 2.72E-06 4.20E-53 mr1991_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220251034 NA 4.82E-10 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251