\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220250941:

Variant ID: vg1220250941 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 20250941
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, others allele: 0.00, population size: 53. )

Flanking Sequence (100 bp) in Reference Genome:


TGGCCCCAAGATCGCATAAGGCTTGGTTGAAATGCAATGTCCCAATTGAGCATGATATCGTGGGACACCCTGGATTTTTCTTCTTTTCCGGGAGTCAGTG[G/A]
AGTATAGCATTGCTACACTCCTCCGTAAGCTTGACCATCTCCATGGTAGGCAGTGGCCTCTTGTTGTTCAGGATGTCTTTGAGATAGCGGGCGTATATTG

Reverse complement sequence

CAATATACGCCCGCTATCTCAAAGACATCCTGAACAACAAGAGGCCACTGCCTACCATGGAGATGGTCAAGCTTACGGAGGAGTGTAGCAATGCTATACT[C/T]
CACTGACTCCCGGAAAAGAAGAAAAATCCAGGGTGTCCCACGATATCATGCTCAATTGGGACATTGCATTTCAACCAAGCCTTATGCGATCTTGGGGCCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.00% 4.80% 15.21% 45.96% NA
All Indica  2759 16.10% 7.60% 24.32% 52.05% NA
All Japonica  1512 70.80% 0.10% 0.33% 28.84% NA
Aus  269 14.50% 4.50% 12.27% 68.77% NA
Indica I  595 36.50% 8.40% 22.02% 33.11% NA
Indica II  465 16.80% 11.00% 39.35% 32.90% NA
Indica III  913 2.80% 4.70% 15.77% 76.67% NA
Indica Intermediate  786 15.50% 8.30% 27.10% 49.11% NA
Temperate Japonica  767 95.30% 0.00% 0.13% 4.56% NA
Tropical Japonica  504 33.10% 0.00% 0.79% 66.07% NA
Japonica Intermediate  241 71.40% 0.40% 0.00% 28.22% NA
VI/Aromatic  96 13.50% 0.00% 2.08% 84.38% NA
Intermediate  90 47.80% 5.60% 8.89% 37.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1220250941 G -> DEL N N silent_mutation Average:24.501; most accessible tissue: Callus, score: 59.152 N N N N
vg1220250941 G -> A LOC_Os12g33510.1 upstream_gene_variant ; 1498.0bp to feature; MODIFIER silent_mutation Average:24.501; most accessible tissue: Callus, score: 59.152 N N N N
vg1220250941 G -> A LOC_Os12g33520.1 downstream_gene_variant ; 174.0bp to feature; MODIFIER silent_mutation Average:24.501; most accessible tissue: Callus, score: 59.152 N N N N
vg1220250941 G -> A LOC_Os12g33510-LOC_Os12g33520 intergenic_region ; MODIFIER silent_mutation Average:24.501; most accessible tissue: Callus, score: 59.152 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1220250941 6.61E-07 2.86E-07 mr1018 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220250941 6.87E-06 NA mr1132 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220250941 3.96E-17 7.24E-108 mr1334 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220250941 2.35E-10 8.12E-15 mr1334 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220250941 9.19E-06 4.76E-14 mr1334 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220250941 NA 2.45E-06 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220250941 8.31E-16 1.58E-111 mr1334_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220250941 2.63E-06 7.80E-10 mr1334_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220250941 9.90E-07 7.93E-18 mr1334_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220250941 1.47E-06 6.24E-54 mr1991_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220250941 8.58E-06 5.58E-10 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251