\
| Variant ID: vg1220250941 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 20250941 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, others allele: 0.00, population size: 53. )
TGGCCCCAAGATCGCATAAGGCTTGGTTGAAATGCAATGTCCCAATTGAGCATGATATCGTGGGACACCCTGGATTTTTCTTCTTTTCCGGGAGTCAGTG[G/A]
AGTATAGCATTGCTACACTCCTCCGTAAGCTTGACCATCTCCATGGTAGGCAGTGGCCTCTTGTTGTTCAGGATGTCTTTGAGATAGCGGGCGTATATTG
CAATATACGCCCGCTATCTCAAAGACATCCTGAACAACAAGAGGCCACTGCCTACCATGGAGATGGTCAAGCTTACGGAGGAGTGTAGCAATGCTATACT[C/T]
CACTGACTCCCGGAAAAGAAGAAAAATCCAGGGTGTCCCACGATATCATGCTCAATTGGGACATTGCATTTCAACCAAGCCTTATGCGATCTTGGGGCCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 34.00% | 4.80% | 15.21% | 45.96% | NA |
| All Indica | 2759 | 16.10% | 7.60% | 24.32% | 52.05% | NA |
| All Japonica | 1512 | 70.80% | 0.10% | 0.33% | 28.84% | NA |
| Aus | 269 | 14.50% | 4.50% | 12.27% | 68.77% | NA |
| Indica I | 595 | 36.50% | 8.40% | 22.02% | 33.11% | NA |
| Indica II | 465 | 16.80% | 11.00% | 39.35% | 32.90% | NA |
| Indica III | 913 | 2.80% | 4.70% | 15.77% | 76.67% | NA |
| Indica Intermediate | 786 | 15.50% | 8.30% | 27.10% | 49.11% | NA |
| Temperate Japonica | 767 | 95.30% | 0.00% | 0.13% | 4.56% | NA |
| Tropical Japonica | 504 | 33.10% | 0.00% | 0.79% | 66.07% | NA |
| Japonica Intermediate | 241 | 71.40% | 0.40% | 0.00% | 28.22% | NA |
| VI/Aromatic | 96 | 13.50% | 0.00% | 2.08% | 84.38% | NA |
| Intermediate | 90 | 47.80% | 5.60% | 8.89% | 37.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1220250941 | G -> DEL | N | N | silent_mutation | Average:24.501; most accessible tissue: Callus, score: 59.152 | N | N | N | N |
| vg1220250941 | G -> A | LOC_Os12g33510.1 | upstream_gene_variant ; 1498.0bp to feature; MODIFIER | silent_mutation | Average:24.501; most accessible tissue: Callus, score: 59.152 | N | N | N | N |
| vg1220250941 | G -> A | LOC_Os12g33520.1 | downstream_gene_variant ; 174.0bp to feature; MODIFIER | silent_mutation | Average:24.501; most accessible tissue: Callus, score: 59.152 | N | N | N | N |
| vg1220250941 | G -> A | LOC_Os12g33510-LOC_Os12g33520 | intergenic_region ; MODIFIER | silent_mutation | Average:24.501; most accessible tissue: Callus, score: 59.152 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1220250941 | 6.61E-07 | 2.86E-07 | mr1018 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220250941 | 6.87E-06 | NA | mr1132 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220250941 | 3.96E-17 | 7.24E-108 | mr1334 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220250941 | 2.35E-10 | 8.12E-15 | mr1334 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220250941 | 9.19E-06 | 4.76E-14 | mr1334 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220250941 | NA | 2.45E-06 | mr1718 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220250941 | 8.31E-16 | 1.58E-111 | mr1334_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220250941 | 2.63E-06 | 7.80E-10 | mr1334_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220250941 | 9.90E-07 | 7.93E-18 | mr1334_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220250941 | 1.47E-06 | 6.24E-54 | mr1991_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220250941 | 8.58E-06 | 5.58E-10 | mr1991_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |