Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1220250941:

Variant ID: vg1220250941 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 20250941
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, others allele: 0.00, population size: 53. )

Flanking Sequence (100 bp) in Reference Genome:

TGGCCCCAAGATCGCATAAGGCTTGGTTGAAATGCAATGTCCCAATTGAGCATGATATCGTGGGACACCCTGGATTTTTCTTCTTTTCCGGGAGTCAGTG[G/A]
AGTATAGCATTGCTACACTCCTCCGTAAGCTTGACCATCTCCATGGTAGGCAGTGGCCTCTTGTTGTTCAGGATGTCTTTGAGATAGCGGGCGTATATTG

Reverse complement sequence

CAATATACGCCCGCTATCTCAAAGACATCCTGAACAACAAGAGGCCACTGCCTACCATGGAGATGGTCAAGCTTACGGAGGAGTGTAGCAATGCTATACT[C/T]
CACTGACTCCCGGAAAAGAAGAAAAATCCAGGGTGTCCCACGATATCATGCTCAATTGGGACATTGCATTTCAACCAAGCCTTATGCGATCTTGGGGCCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	34.00%	4.80%	15.21%	45.96%	NA
All Indica	2759	16.10%	7.60%	24.32%	52.05%	NA
All Japonica	1512	70.80%	0.10%	0.33%	28.84%	NA
Aus	269	14.50%	4.50%	12.27%	68.77%	NA
Indica I	595	36.50%	8.40%	22.02%	33.11%	NA
Indica II	465	16.80%	11.00%	39.35%	32.90%	NA
Indica III	913	2.80%	4.70%	15.77%	76.67%	NA
Indica Intermediate	786	15.50%	8.30%	27.10%	49.11%	NA
Temperate Japonica	767	95.30%	0.00%	0.13%	4.56%	NA
Tropical Japonica	504	33.10%	0.00%	0.79%	66.07%	NA
Japonica Intermediate	241	71.40%	0.40%	0.00%	28.22%	NA
VI/Aromatic	96	13.50%	0.00%	2.08%	84.38%	NA
Intermediate	90	47.80%	5.60%	8.89%	37.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1220250941	G -> DEL	N	N	silent_mutation	Average:24.501; most accessible tissue: Callus, score: 59.152	N	N	N	N
vg1220250941	G -> A	LOC_Os12g33510.1	upstream_gene_variant ; 1498.0bp to feature; MODIFIER	silent_mutation	Average:24.501; most accessible tissue: Callus, score: 59.152	N	N	N	N
vg1220250941	G -> A	LOC_Os12g33520.1	downstream_gene_variant ; 174.0bp to feature; MODIFIER	silent_mutation	Average:24.501; most accessible tissue: Callus, score: 59.152	N	N	N	N
vg1220250941	G -> A	LOC_Os12g33510-LOC_Os12g33520	intergenic_region ; MODIFIER	silent_mutation	Average:24.501; most accessible tissue: Callus, score: 59.152	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1220250941	6.61E-07	2.86E-07	mr1018	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220250941	6.87E-06	NA	mr1132	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220250941	3.96E-17	7.24E-108	mr1334	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220250941	2.35E-10	8.12E-15	mr1334	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220250941	9.19E-06	4.76E-14	mr1334	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220250941	NA	2.45E-06	mr1718	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220250941	8.31E-16	1.58E-111	mr1334_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220250941	2.63E-06	7.80E-10	mr1334_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220250941	9.90E-07	7.93E-18	mr1334_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220250941	1.47E-06	6.24E-54	mr1991_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220250941	8.58E-06	5.58E-10	mr1991_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251