Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220249911:

Variant ID: vg1220249911 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 20249911
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCCGGATTAGGTAACATGATTTCATTTATACAACCGGGATAGAAAAATATTAAAGATCCATTTGCTCCATGCTTAAGAGTGTGTCCTTGCACTAGATATG[T/A]
TTCATCGATATAAACACGAGGGGTTGAAATGTAAGCAATTTGATCATTTGTAATAACCCCAAGCCCTCTTGCTATACGAGTGATCAAGGAAGTTCATTCA

Reverse complement sequence

TGAATGAACTTCCTTGATCACTCGTATAGCAAGAGGGCTTGGGGTTATTACAAATGATCAAATTGCTTACATTTCAACCCCTCGTGTTTATATCGATGAA[A/T]
CATATCTAGTGCAAGGACACACTCTTAAGCATGGAGCAAATGGATCTTTAATATTTTTCTATCCCGGTTGTATAAATGAAATCATGTTACCTAATCCGGG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	33.00%	26.20%	0.87%	39.97%	NA
All Indica	2759	14.60%	42.50%	0.98%	41.90%	NA
All Japonica	1512	70.20%	0.50%	0.00%	29.37%	NA
Aus	269	13.80%	13.80%	4.83%	67.66%	NA
Indica I	595	34.30%	49.90%	0.84%	14.96%	NA
Indica II	465	15.50%	69.70%	0.22%	14.62%	NA
Indica III	913	2.20%	23.20%	1.10%	73.49%	NA
Indica Intermediate	786	13.60%	43.30%	1.40%	41.73%	NA
Temperate Japonica	767	95.20%	0.10%	0.00%	4.69%	NA
Tropical Japonica	504	32.30%	0.80%	0.00%	66.87%	NA
Japonica Intermediate	241	69.70%	0.80%	0.00%	29.46%	NA
VI/Aromatic	96	14.60%	5.20%	0.00%	80.21%	NA
Intermediate	90	47.80%	17.80%	1.11%	33.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1220249911	T -> DEL	N	N	silent_mutation	Average:20.861; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N
vg1220249911	T -> A	LOC_Os12g33510.1	upstream_gene_variant ; 468.0bp to feature; MODIFIER	silent_mutation	Average:20.861; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N
vg1220249911	T -> A	LOC_Os12g33520.1	downstream_gene_variant ; 1204.0bp to feature; MODIFIER	silent_mutation	Average:20.861; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N
vg1220249911	T -> A	LOC_Os12g33510-LOC_Os12g33520	intergenic_region ; MODIFIER	silent_mutation	Average:20.861; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1220249911	NA	4.53E-06	mr1018	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220249911	8.48E-07	NA	mr1132	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220249911	3.27E-17	1.13E-110	mr1334	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220249911	2.46E-11	7.77E-16	mr1334	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220249911	NA	8.75E-06	mr1415	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220249911	4.53E-06	3.96E-07	mr1489	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220249911	NA	8.75E-06	mr1567	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220249911	NA	5.27E-06	mr1718	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220249911	NA	1.39E-06	mr1750	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220249911	NA	1.41E-12	mr1248_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220249911	1.07E-15	6.48E-115	mr1334_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220249911	4.43E-06	9.26E-10	mr1334_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220249911	3.43E-06	3.81E-16	mr1334_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220249911	3.30E-06	1.04E-54	mr1991_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220249911	NA	3.51E-09	mr1991_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251