\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220237342:

Variant ID: vg1220237342 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 20237342
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 46. )

Flanking Sequence (100 bp) in Reference Genome:


TTAATGAAAATTCCTACCAAAGCAAAAAATGTGCTATCATGATTAAACCATATACATTTTGGTTACTTGCCATTCCATTAAACTTTGTCAAACTCTTGTG[A/G]
CTTGTGTAGATACATTTCATGCTCTATGATCAAGATCATACACCCACATTTATGCACATGCTAAACTCCTACACTGGGAGCTAAGCAATATTCCATTTCA

Reverse complement sequence

TGAAATGGAATATTGCTTAGCTCCCAGTGTAGGAGTTTAGCATGTGCATAAATGTGGGTGTATGATCTTGATCATAGAGCATGAAATGTATCTACACAAG[T/C]
CACAAGAGTTTGACAAAGTTTAATGGAATGGCAAGTAACCAAAATGTATATGGTTTAATCATGATAGCACATTTTTTGCTTTGGTAGGAATTTTCATTAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.50% 19.70% 7.96% 38.89% NA
All Indica  2759 15.20% 33.00% 8.74% 43.06% NA
All Japonica  1512 70.80% 0.40% 7.08% 21.76% NA
Aus  269 13.40% 1.90% 5.20% 79.55% NA
Indica I  595 33.60% 20.80% 7.73% 37.82% NA
Indica II  465 15.30% 37.60% 8.17% 38.92% NA
Indica III  913 3.40% 38.00% 8.43% 50.16% NA
Indica Intermediate  786 15.00% 33.60% 10.18% 41.22% NA
Temperate Japonica  767 95.20% 0.40% 0.91% 3.52% NA
Tropical Japonica  504 33.90% 0.40% 16.87% 48.81% NA
Japonica Intermediate  241 70.10% 0.40% 6.22% 23.24% NA
VI/Aromatic  96 12.50% 1.00% 7.29% 79.17% NA
Intermediate  90 50.00% 7.80% 7.78% 34.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1220237342 A -> DEL N N silent_mutation Average:8.275; most accessible tissue: Callus, score: 15.114 N N N N
vg1220237342 A -> G LOC_Os12g33480.1 upstream_gene_variant ; 4808.0bp to feature; MODIFIER silent_mutation Average:8.275; most accessible tissue: Callus, score: 15.114 N N N N
vg1220237342 A -> G LOC_Os12g33490.1 downstream_gene_variant ; 3078.0bp to feature; MODIFIER silent_mutation Average:8.275; most accessible tissue: Callus, score: 15.114 N N N N
vg1220237342 A -> G LOC_Os12g33500.1 downstream_gene_variant ; 558.0bp to feature; MODIFIER silent_mutation Average:8.275; most accessible tissue: Callus, score: 15.114 N N N N
vg1220237342 A -> G LOC_Os12g33500-LOC_Os12g33510 intergenic_region ; MODIFIER silent_mutation Average:8.275; most accessible tissue: Callus, score: 15.114 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1220237342 NA 4.09E-10 mr1109 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220237342 NA 2.66E-10 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220237342 NA 6.45E-06 mr1235 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220237342 NA 6.22E-08 mr1236 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220237342 NA 5.19E-08 mr1236 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220237342 NA 2.79E-07 mr1251 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220237342 NA 2.86E-19 mr1255 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220237342 NA 2.09E-08 mr1255 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220237342 NA 2.46E-11 mr1257 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220237342 NA 2.00E-07 mr1423 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220237342 NA 5.46E-08 mr1435 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220237342 NA 5.76E-08 mr1599 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220237342 NA 9.32E-06 mr1013_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220237342 NA 1.43E-06 mr1015_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220237342 NA 5.65E-08 mr1089_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220237342 NA 6.44E-08 mr1093_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220237342 NA 9.00E-13 mr1109_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220237342 4.56E-07 NA mr1129_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220237342 1.79E-06 1.24E-15 mr1129_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220237342 NA 9.29E-08 mr1235_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220237342 NA 7.83E-09 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220237342 NA 2.55E-08 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220237342 4.87E-06 2.30E-11 mr1251_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220237342 NA 1.90E-06 mr1253_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220237342 5.59E-06 1.40E-24 mr1255_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220237342 NA 3.18E-13 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220237342 1.55E-06 7.06E-34 mr1257_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220237342 NA 5.63E-16 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220237342 NA 1.32E-07 mr1423_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220237342 4.60E-06 2.03E-11 mr1435_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220237342 NA 4.01E-11 mr1599_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220237342 NA 2.04E-09 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220237342 NA 3.63E-07 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220237342 NA 2.60E-06 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251