\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220222656:

Variant ID: vg1220222656 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 20222656
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAGATATGTATGTACATACTGCATGATTTAAAATTAATAAAAATTGTAATCATCATATATACTTAGCGTAGGAATTATATTAAATTAAATGTTAAAAACT[A/C]
TAATTAACATATGTAAATGCCACATGCATGATTTAAACCTTTTAAAAATTTGAATAGTCATATATAAGTAGCATATGAAAGATAGTAAATTAAATTGTGA

Reverse complement sequence

TCACAATTTAATTTACTATCTTTCATATGCTACTTATATATGACTATTCAAATTTTTAAAAGGTTTAAATCATGCATGTGGCATTTACATATGTTAATTA[T/G]
AGTTTTTAACATTTAATTTAATATAATTCCTACGCTAAGTATATATGATGATTACAATTTTTATTAATTTTAAATCATGCAGTATGTACATACATATCTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.20% 1.60% 15.00% 50.19% NA
All Indica  2759 14.80% 0.40% 18.59% 66.22% NA
All Japonica  1512 70.20% 1.90% 4.43% 23.41% NA
Aus  269 16.40% 1.10% 37.92% 44.61% NA
Indica I  595 31.90% 0.30% 8.40% 59.33% NA
Indica II  465 14.40% 0.20% 8.39% 76.99% NA
Indica III  913 3.80% 0.50% 33.84% 61.77% NA
Indica Intermediate  786 14.90% 0.30% 14.63% 70.23% NA
Temperate Japonica  767 95.30% 1.00% 1.43% 2.22% NA
Tropical Japonica  504 35.10% 0.20% 8.93% 55.75% NA
Japonica Intermediate  241 63.90% 8.30% 4.56% 23.24% NA
VI/Aromatic  96 13.50% 31.20% 14.58% 40.62% NA
Intermediate  90 44.40% 5.60% 14.44% 35.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1220222656 A -> C LOC_Os12g33450.1 upstream_gene_variant ; 4580.0bp to feature; MODIFIER silent_mutation Average:6.533; most accessible tissue: Minghui63 flower, score: 11.139 N N N N
vg1220222656 A -> C LOC_Os12g33470.1 upstream_gene_variant ; 4408.0bp to feature; MODIFIER silent_mutation Average:6.533; most accessible tissue: Minghui63 flower, score: 11.139 N N N N
vg1220222656 A -> C LOC_Os12g33460.1 intron_variant ; MODIFIER silent_mutation Average:6.533; most accessible tissue: Minghui63 flower, score: 11.139 N N N N
vg1220222656 A -> DEL N N silent_mutation Average:6.533; most accessible tissue: Minghui63 flower, score: 11.139 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1220222656 1.57E-08 NA mr1334 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220222656 2.21E-07 NA mr1334 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220222656 6.21E-06 NA mr1334_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251