Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220186546:

Variant ID: vg1220186546 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 20186546
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGATAAGGCGAAAGAAAATCAATCTGCTGCGGAAAAAAGGGATCTAACTGATGGGTGCTTACCTCTGCGTATTCGGCCGATGGCGCGGCGGATAGATTGG[T/C]
GGAAGTTGACATTACCGCGGGTGGAGATCTGGCTGGGGACGGAATCGTCTTGAAATCGCCTGGTGCGTCGAAGGAATCGCCGGAGAGAAAGAGGGTAAAG

Reverse complement sequence

CTTTACCCTCTTTCTCTCCGGCGATTCCTTCGACGCACCAGGCGATTTCAAGACGATTCCGTCCCCAGCCAGATCTCCACCCGCGGTAATGTCAACTTCC[A/G]
CCAATCTATCCGCCGCGCCATCGGCCGAATACGCAGAGGTAAGCACCCATCAGTTAGATCCCTTTTTTCCGCAGCAGATTGATTTTCTTTCGCCTTATCT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	31.20%	1.70%	46.64%	20.46%	NA
All Indica	2759	12.90%	0.60%	70.61%	15.91%	NA
All Japonica	1512	68.10%	1.60%	2.65%	27.65%	NA
Aus	269	12.60%	13.80%	66.17%	7.43%	NA
Indica I	595	28.40%	0.70%	50.08%	20.84%	NA
Indica II	465	13.30%	0.20%	69.46%	16.99%	NA
Indica III	913	2.00%	1.00%	85.54%	11.50%	NA
Indica Intermediate	786	13.50%	0.40%	69.47%	16.67%	NA
Temperate Japonica	767	94.10%	0.80%	0.39%	4.69%	NA
Tropical Japonica	504	30.80%	0.60%	6.55%	62.10%	NA
Japonica Intermediate	241	63.50%	6.20%	1.66%	28.63%	NA
VI/Aromatic	96	16.70%	0.00%	8.33%	75.00%	NA
Intermediate	90	45.60%	1.10%	33.33%	20.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1220186546	T -> C	LOC_Os12g33380.1	upstream_gene_variant ; 518.0bp to feature; MODIFIER	silent_mutation	Average:27.051; most accessible tissue: Minghui63 root, score: 36.81	N	N	N	N
vg1220186546	T -> C	LOC_Os12g33370.1	downstream_gene_variant ; 3432.0bp to feature; MODIFIER	silent_mutation	Average:27.051; most accessible tissue: Minghui63 root, score: 36.81	N	N	N	N
vg1220186546	T -> C	LOC_Os12g33390.1	downstream_gene_variant ; 1680.0bp to feature; MODIFIER	silent_mutation	Average:27.051; most accessible tissue: Minghui63 root, score: 36.81	N	N	N	N
vg1220186546	T -> C	LOC_Os12g33380-LOC_Os12g33390	intergenic_region ; MODIFIER	silent_mutation	Average:27.051; most accessible tissue: Minghui63 root, score: 36.81	N	N	N	N
vg1220186546	T -> DEL	N	N	silent_mutation	Average:27.051; most accessible tissue: Minghui63 root, score: 36.81	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1220186546	9.31E-11	5.41E-87	mr1334	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220186546	7.68E-09	5.75E-11	mr1334	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220186546	NA	1.22E-20	mr1588	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220186546	1.35E-10	NA	mr1334_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220186546	3.97E-08	6.46E-11	mr1334_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220186546	NA	1.35E-24	mr1350_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220186546	NA	5.78E-26	mr1588_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251