Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220186069:

Variant ID: vg1220186069 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 20186069
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.86, C: 0.14, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:

GGCCGATGAGGTGACATCCAAACCCGTGATCATAATGATGTCTATGAGAGTTGGGGTCATCGGCCCTTGGTTGAATAAGAAGGCATTGATGGCGTTGGAC[T/C]
AGAAATAGGTGGCGGCAGCCATTAGAGGTTCGTCCTTAGCAGAATTAGCTATGGTAAGGGCAAGCGCTTGGCTGATTCTGATCTCATCCCAGTGTGCTGC

Reverse complement sequence

GCAGCACACTGGGATGAGATCAGAATCAGCCAAGCGCTTGCCCTTACCATAGCTAATTCTGCTAAGGACGAACCTCTAATGGCTGCCGCCACCTATTTCT[A/G]
GTCCAACGCCATCAATGCCTTCTTATTCAACCAAGGGCCGATGACCCCAACTCTCATAGACATCATTATGATCACGGGTTTGGATGTCACCTCATCGGCC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.30%	35.40%	2.41%	3.89%	NA
All Indica	2759	53.00%	44.90%	1.70%	0.40%	NA
All Japonica	1512	64.30%	24.80%	3.77%	7.14%	NA
Aus	269	87.70%	9.70%	0.74%	1.86%	NA
Indica I	595	36.30%	59.70%	3.53%	0.50%	NA
Indica II	465	60.20%	38.30%	1.29%	0.22%	NA
Indica III	913	58.90%	40.20%	0.55%	0.33%	NA
Indica Intermediate	786	54.60%	43.00%	1.91%	0.51%	NA
Temperate Japonica	767	92.70%	2.00%	1.17%	4.17%	NA
Tropical Japonica	504	26.20%	59.50%	5.75%	8.53%	NA
Japonica Intermediate	241	53.50%	24.90%	7.88%	13.69%	NA
VI/Aromatic	96	24.00%	10.40%	6.25%	59.38%	NA
Intermediate	90	65.60%	28.90%	2.22%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1220186069	T -> C	LOC_Os12g33380.1	upstream_gene_variant ; 41.0bp to feature; MODIFIER	silent_mutation	Average:18.772; most accessible tissue: Callus, score: 32.33	N	N	N	N
vg1220186069	T -> C	LOC_Os12g33370.1	downstream_gene_variant ; 2955.0bp to feature; MODIFIER	silent_mutation	Average:18.772; most accessible tissue: Callus, score: 32.33	N	N	N	N
vg1220186069	T -> C	LOC_Os12g33390.1	downstream_gene_variant ; 2157.0bp to feature; MODIFIER	silent_mutation	Average:18.772; most accessible tissue: Callus, score: 32.33	N	N	N	N
vg1220186069	T -> C	LOC_Os12g33380-LOC_Os12g33390	intergenic_region ; MODIFIER	silent_mutation	Average:18.772; most accessible tissue: Callus, score: 32.33	N	N	N	N
vg1220186069	T -> DEL	N	N	silent_mutation	Average:18.772; most accessible tissue: Callus, score: 32.33	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1220186069	NA	2.42E-06	mr1013	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220186069	NA	8.85E-11	mr1093	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220186069	NA	3.41E-07	mr1129	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220186069	2.19E-08	6.45E-20	mr1334	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220186069	NA	2.23E-06	mr1671	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220186069	NA	7.39E-06	mr1686	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220186069	NA	3.40E-10	mr1089_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220186069	NA	2.83E-10	mr1093_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220186069	NA	2.05E-09	mr1235_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220186069	NA	2.93E-07	mr1257_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220186069	1.45E-08	NA	mr1334_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220186069	2.36E-08	1.00E-22	mr1334_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220186069	NA	1.61E-07	mr1553_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220186069	NA	1.17E-07	mr1599_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220186069	NA	3.22E-07	mr1671_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220186069	NA	1.22E-08	mr1817_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220186069	NA	1.90E-09	mr1862_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220186069	NA	2.80E-10	mr1991_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251