\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220186069:

Variant ID: vg1220186069 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 20186069
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.86, C: 0.14, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:


GGCCGATGAGGTGACATCCAAACCCGTGATCATAATGATGTCTATGAGAGTTGGGGTCATCGGCCCTTGGTTGAATAAGAAGGCATTGATGGCGTTGGAC[T/C]
AGAAATAGGTGGCGGCAGCCATTAGAGGTTCGTCCTTAGCAGAATTAGCTATGGTAAGGGCAAGCGCTTGGCTGATTCTGATCTCATCCCAGTGTGCTGC

Reverse complement sequence

GCAGCACACTGGGATGAGATCAGAATCAGCCAAGCGCTTGCCCTTACCATAGCTAATTCTGCTAAGGACGAACCTCTAATGGCTGCCGCCACCTATTTCT[A/G]
GTCCAACGCCATCAATGCCTTCTTATTCAACCAAGGGCCGATGACCCCAACTCTCATAGACATCATTATGATCACGGGTTTGGATGTCACCTCATCGGCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.30% 35.40% 2.41% 3.89% NA
All Indica  2759 53.00% 44.90% 1.70% 0.40% NA
All Japonica  1512 64.30% 24.80% 3.77% 7.14% NA
Aus  269 87.70% 9.70% 0.74% 1.86% NA
Indica I  595 36.30% 59.70% 3.53% 0.50% NA
Indica II  465 60.20% 38.30% 1.29% 0.22% NA
Indica III  913 58.90% 40.20% 0.55% 0.33% NA
Indica Intermediate  786 54.60% 43.00% 1.91% 0.51% NA
Temperate Japonica  767 92.70% 2.00% 1.17% 4.17% NA
Tropical Japonica  504 26.20% 59.50% 5.75% 8.53% NA
Japonica Intermediate  241 53.50% 24.90% 7.88% 13.69% NA
VI/Aromatic  96 24.00% 10.40% 6.25% 59.38% NA
Intermediate  90 65.60% 28.90% 2.22% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1220186069 T -> C LOC_Os12g33380.1 upstream_gene_variant ; 41.0bp to feature; MODIFIER silent_mutation Average:18.772; most accessible tissue: Callus, score: 32.33 N N N N
vg1220186069 T -> C LOC_Os12g33370.1 downstream_gene_variant ; 2955.0bp to feature; MODIFIER silent_mutation Average:18.772; most accessible tissue: Callus, score: 32.33 N N N N
vg1220186069 T -> C LOC_Os12g33390.1 downstream_gene_variant ; 2157.0bp to feature; MODIFIER silent_mutation Average:18.772; most accessible tissue: Callus, score: 32.33 N N N N
vg1220186069 T -> C LOC_Os12g33380-LOC_Os12g33390 intergenic_region ; MODIFIER silent_mutation Average:18.772; most accessible tissue: Callus, score: 32.33 N N N N
vg1220186069 T -> DEL N N silent_mutation Average:18.772; most accessible tissue: Callus, score: 32.33 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1220186069 NA 2.42E-06 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220186069 NA 8.85E-11 mr1093 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220186069 NA 3.41E-07 mr1129 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220186069 2.19E-08 6.45E-20 mr1334 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220186069 NA 2.23E-06 mr1671 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220186069 NA 7.39E-06 mr1686 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220186069 NA 3.40E-10 mr1089_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220186069 NA 2.83E-10 mr1093_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220186069 NA 2.05E-09 mr1235_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220186069 NA 2.93E-07 mr1257_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220186069 1.45E-08 NA mr1334_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220186069 2.36E-08 1.00E-22 mr1334_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220186069 NA 1.61E-07 mr1553_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220186069 NA 1.17E-07 mr1599_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220186069 NA 3.22E-07 mr1671_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220186069 NA 1.22E-08 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220186069 NA 1.90E-09 mr1862_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220186069 NA 2.80E-10 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251