\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220179248:

Variant ID: vg1220179248 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 20179248
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCGCGTCTCGCCTTCGTCCAAGGATCGCCGCCGAAGTCGCTCCCTCGCCGTTCGCCTCCGTCGTCTCCGAGCCGTCTCCGCCGTGCTCGTTCGTCTTTGT[T/C]
GTTCCCACGCCTCGTTGCGTGGTGGTAAGGGTCCATCCTCTCGCTGCCCCGTCCTAGTCCTTTCGGTGTCGCCCGTGCCTGTTGTGCGGTTGTCGACCCC

Reverse complement sequence

GGGGTCGACAACCGCACAACAGGCACGGGCGACACCGAAAGGACTAGGACGGGGCAGCGAGAGGATGGACCCTTACCACCACGCAACGAGGCGTGGGAAC[A/G]
ACAAAGACGAACGAGCACGGCGGAGACGGCTCGGAGACGACGGAGGCGAACGGCGAGGGAGCGACTTCGGCGGCGATCCTTGGACGAAGGCGAGACGCGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.80% 19.70% 8.78% 1.69% NA
All Indica  2759 87.60% 4.80% 7.43% 0.18% NA
All Japonica  1512 33.50% 49.10% 12.50% 4.89% NA
Aus  269 90.00% 7.80% 2.23% 0.00% NA
Indica I  595 70.40% 9.40% 20.00% 0.17% NA
Indica II  465 87.70% 6.20% 5.59% 0.43% NA
Indica III  913 98.00% 0.90% 1.10% 0.00% NA
Indica Intermediate  786 88.30% 5.10% 6.36% 0.25% NA
Temperate Japonica  767 6.60% 66.10% 18.64% 8.60% NA
Tropical Japonica  504 72.40% 22.80% 4.17% 0.60% NA
Japonica Intermediate  241 37.30% 50.20% 10.37% 2.07% NA
VI/Aromatic  96 84.40% 11.50% 4.17% 0.00% NA
Intermediate  90 60.00% 26.70% 12.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1220179248 T -> C LOC_Os12g33370.1 upstream_gene_variant ; 1251.0bp to feature; MODIFIER silent_mutation Average:36.166; most accessible tissue: Minghui63 young leaf, score: 55.178 N N N N
vg1220179248 T -> C LOC_Os12g33360.1 downstream_gene_variant ; 1729.0bp to feature; MODIFIER silent_mutation Average:36.166; most accessible tissue: Minghui63 young leaf, score: 55.178 N N N N
vg1220179248 T -> C LOC_Os12g33380.1 downstream_gene_variant ; 4347.0bp to feature; MODIFIER silent_mutation Average:36.166; most accessible tissue: Minghui63 young leaf, score: 55.178 N N N N
vg1220179248 T -> C LOC_Os12g33360-LOC_Os12g33370 intergenic_region ; MODIFIER silent_mutation Average:36.166; most accessible tissue: Minghui63 young leaf, score: 55.178 N N N N
vg1220179248 T -> DEL N N silent_mutation Average:36.166; most accessible tissue: Minghui63 young leaf, score: 55.178 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1220179248 NA 5.99E-17 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220179248 1.07E-14 2.19E-100 mr1334 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220179248 NA 1.95E-14 mr1334 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220179248 7.34E-25 5.53E-125 mr1334_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220179248 6.46E-10 6.33E-14 mr1334_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220179248 NA 7.44E-20 mr1334_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220179248 3.19E-10 8.15E-61 mr1991_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220179248 NA 4.91E-11 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251