\
| Variant ID: vg1220179248 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 20179248 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CCGCGTCTCGCCTTCGTCCAAGGATCGCCGCCGAAGTCGCTCCCTCGCCGTTCGCCTCCGTCGTCTCCGAGCCGTCTCCGCCGTGCTCGTTCGTCTTTGT[T/C]
GTTCCCACGCCTCGTTGCGTGGTGGTAAGGGTCCATCCTCTCGCTGCCCCGTCCTAGTCCTTTCGGTGTCGCCCGTGCCTGTTGTGCGGTTGTCGACCCC
GGGGTCGACAACCGCACAACAGGCACGGGCGACACCGAAAGGACTAGGACGGGGCAGCGAGAGGATGGACCCTTACCACCACGCAACGAGGCGTGGGAAC[A/G]
ACAAAGACGAACGAGCACGGCGGAGACGGCTCGGAGACGACGGAGGCGAACGGCGAGGGAGCGACTTCGGCGGCGATCCTTGGACGAAGGCGAGACGCGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.80% | 19.70% | 8.78% | 1.69% | NA |
| All Indica | 2759 | 87.60% | 4.80% | 7.43% | 0.18% | NA |
| All Japonica | 1512 | 33.50% | 49.10% | 12.50% | 4.89% | NA |
| Aus | 269 | 90.00% | 7.80% | 2.23% | 0.00% | NA |
| Indica I | 595 | 70.40% | 9.40% | 20.00% | 0.17% | NA |
| Indica II | 465 | 87.70% | 6.20% | 5.59% | 0.43% | NA |
| Indica III | 913 | 98.00% | 0.90% | 1.10% | 0.00% | NA |
| Indica Intermediate | 786 | 88.30% | 5.10% | 6.36% | 0.25% | NA |
| Temperate Japonica | 767 | 6.60% | 66.10% | 18.64% | 8.60% | NA |
| Tropical Japonica | 504 | 72.40% | 22.80% | 4.17% | 0.60% | NA |
| Japonica Intermediate | 241 | 37.30% | 50.20% | 10.37% | 2.07% | NA |
| VI/Aromatic | 96 | 84.40% | 11.50% | 4.17% | 0.00% | NA |
| Intermediate | 90 | 60.00% | 26.70% | 12.22% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1220179248 | T -> C | LOC_Os12g33370.1 | upstream_gene_variant ; 1251.0bp to feature; MODIFIER | silent_mutation | Average:36.166; most accessible tissue: Minghui63 young leaf, score: 55.178 | N | N | N | N |
| vg1220179248 | T -> C | LOC_Os12g33360.1 | downstream_gene_variant ; 1729.0bp to feature; MODIFIER | silent_mutation | Average:36.166; most accessible tissue: Minghui63 young leaf, score: 55.178 | N | N | N | N |
| vg1220179248 | T -> C | LOC_Os12g33380.1 | downstream_gene_variant ; 4347.0bp to feature; MODIFIER | silent_mutation | Average:36.166; most accessible tissue: Minghui63 young leaf, score: 55.178 | N | N | N | N |
| vg1220179248 | T -> C | LOC_Os12g33360-LOC_Os12g33370 | intergenic_region ; MODIFIER | silent_mutation | Average:36.166; most accessible tissue: Minghui63 young leaf, score: 55.178 | N | N | N | N |
| vg1220179248 | T -> DEL | N | N | silent_mutation | Average:36.166; most accessible tissue: Minghui63 young leaf, score: 55.178 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1220179248 | NA | 5.99E-17 | mr1156 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220179248 | 1.07E-14 | 2.19E-100 | mr1334 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220179248 | NA | 1.95E-14 | mr1334 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220179248 | 7.34E-25 | 5.53E-125 | mr1334_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220179248 | 6.46E-10 | 6.33E-14 | mr1334_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220179248 | NA | 7.44E-20 | mr1334_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220179248 | 3.19E-10 | 8.15E-61 | mr1991_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220179248 | NA | 4.91E-11 | mr1991_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |