Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220174255:

Variant ID: vg1220174255 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 20174255
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 54. )

Flanking Sequence (100 bp) in Reference Genome:

TCCTTATATGTATGGATCGGATGATGAGGATGATGATTCCAAAATAGCTGCAGCCGAGTGGGTCAGGAATAAAAAGGTTATACCATGCCAATGGGTGAAG[G/A]
GCTCAGGAAAAGAGGAAAGGTATGACTTTGACATAACCAAGGCTGATAAGATATTTGATTTGCTACTTCAAGAAAAACAGATTCAATTTCCTACCGGACA

Reverse complement sequence

TGTCCGGTAGGAAATTGAATCTGTTTTTCTTGAAGTAGCAAATCAAATATCTTATCAGCCTTGGTTATGTCAAAGTCATACCTTTCCTCTTTTCCTGAGC[C/T]
CTTCACCCATTGGCATGGTATAACCTTTTTATTCCTGACCCACTCGGCTGCAGCTATTTTGGAATCATCATCCTCATCATCCGATCCATACATATAAGGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	32.40%	1.40%	22.28%	43.91%	NA
All Indica	2759	14.20%	2.40%	19.54%	63.86%	NA
All Japonica	1512	69.30%	0.00%	19.44%	11.24%	NA
Aus	269	13.00%	0.00%	72.86%	14.13%	NA
Indica I	595	32.80%	1.50%	9.92%	55.80%	NA
Indica II	465	15.50%	1.90%	11.40%	71.18%	NA
Indica III	913	2.20%	3.00%	30.23%	64.62%	NA
Indica Intermediate	786	13.50%	2.50%	19.21%	64.76%	NA
Temperate Japonica	767	95.00%	0.00%	1.30%	3.65%	NA
Tropical Japonica	504	29.80%	0.00%	46.43%	23.81%	NA
Japonica Intermediate	241	70.10%	0.00%	20.75%	9.13%	NA
VI/Aromatic	96	16.70%	0.00%	7.29%	76.04%	NA
Intermediate	90	45.60%	0.00%	18.89%	35.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1220174255	G -> DEL	LOC_Os12g33360.1	N	frameshift_variant	Average:13.113; most accessible tissue: Callus, score: 33.002	N	N	N	N
vg1220174255	G -> A	LOC_Os12g33360.1	missense_variant ; p.Gly681Ser; MODERATE	nonsynonymous_codon ; G681N	Average:13.113; most accessible tissue: Callus, score: 33.002	benign	-1.053	TOLERATED	0.56
vg1220174255	G -> A	LOC_Os12g33360.1	missense_variant ; p.Gly681Ser; MODERATE	nonsynonymous_codon ; G681S	Average:13.113; most accessible tissue: Callus, score: 33.002	benign	-1.06	TOLERATED	1.00

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1220174255	NA	8.05E-10	mr1089	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220174255	NA	3.97E-10	mr1093	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220174255	NA	3.36E-06	mr1094	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220174255	NA	1.80E-06	mr1121	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220174255	NA	1.73E-09	mr1251	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220174255	NA	3.85E-07	mr1252	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220174255	3.77E-14	NA	mr1334	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220174255	3.41E-14	4.31E-29	mr1334	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220174255	NA	1.19E-07	mr1403	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220174255	NA	1.03E-10	mr1435	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220174255	NA	2.01E-10	mr1539	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220174255	NA	3.49E-07	mr1671	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220174255	NA	6.25E-10	mr1089_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220174255	NA	1.11E-07	mr1090_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220174255	NA	1.75E-06	mr1096_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220174255	NA	1.74E-06	mr1121_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220174255	NA	2.07E-06	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220174255	NA	5.23E-09	mr1235_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220174255	NA	1.75E-06	mr1250_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220174255	NA	3.25E-06	mr1262_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220174255	2.91E-15	NA	mr1334_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220174255	2.58E-16	2.94E-36	mr1334_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220174255	9.03E-06	9.03E-06	mr1529_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220174255	NA	7.91E-07	mr1671_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220174255	NA	4.49E-06	mr1869_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220174255	NA	1.37E-07	mr1909_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220174255	NA	2.54E-07	mr1921_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220174255	1.25E-11	1.23E-16	mr1991_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251