\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220174255:

Variant ID: vg1220174255 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 20174255
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 54. )

Flanking Sequence (100 bp) in Reference Genome:


TCCTTATATGTATGGATCGGATGATGAGGATGATGATTCCAAAATAGCTGCAGCCGAGTGGGTCAGGAATAAAAAGGTTATACCATGCCAATGGGTGAAG[G/A]
GCTCAGGAAAAGAGGAAAGGTATGACTTTGACATAACCAAGGCTGATAAGATATTTGATTTGCTACTTCAAGAAAAACAGATTCAATTTCCTACCGGACA

Reverse complement sequence

TGTCCGGTAGGAAATTGAATCTGTTTTTCTTGAAGTAGCAAATCAAATATCTTATCAGCCTTGGTTATGTCAAAGTCATACCTTTCCTCTTTTCCTGAGC[C/T]
CTTCACCCATTGGCATGGTATAACCTTTTTATTCCTGACCCACTCGGCTGCAGCTATTTTGGAATCATCATCCTCATCATCCGATCCATACATATAAGGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 32.40% 1.40% 22.28% 43.91% NA
All Indica  2759 14.20% 2.40% 19.54% 63.86% NA
All Japonica  1512 69.30% 0.00% 19.44% 11.24% NA
Aus  269 13.00% 0.00% 72.86% 14.13% NA
Indica I  595 32.80% 1.50% 9.92% 55.80% NA
Indica II  465 15.50% 1.90% 11.40% 71.18% NA
Indica III  913 2.20% 3.00% 30.23% 64.62% NA
Indica Intermediate  786 13.50% 2.50% 19.21% 64.76% NA
Temperate Japonica  767 95.00% 0.00% 1.30% 3.65% NA
Tropical Japonica  504 29.80% 0.00% 46.43% 23.81% NA
Japonica Intermediate  241 70.10% 0.00% 20.75% 9.13% NA
VI/Aromatic  96 16.70% 0.00% 7.29% 76.04% NA
Intermediate  90 45.60% 0.00% 18.89% 35.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1220174255 G -> DEL LOC_Os12g33360.1 N frameshift_variant Average:13.113; most accessible tissue: Callus, score: 33.002 N N N N
vg1220174255 G -> A LOC_Os12g33360.1 missense_variant ; p.Gly681Ser; MODERATE nonsynonymous_codon ; G681N Average:13.113; most accessible tissue: Callus, score: 33.002 benign -1.053 TOLERATED 0.56
vg1220174255 G -> A LOC_Os12g33360.1 missense_variant ; p.Gly681Ser; MODERATE nonsynonymous_codon ; G681S Average:13.113; most accessible tissue: Callus, score: 33.002 benign -1.06 TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1220174255 NA 8.05E-10 mr1089 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220174255 NA 3.97E-10 mr1093 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220174255 NA 3.36E-06 mr1094 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220174255 NA 1.80E-06 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220174255 NA 1.73E-09 mr1251 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220174255 NA 3.85E-07 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220174255 3.77E-14 NA mr1334 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220174255 3.41E-14 4.31E-29 mr1334 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220174255 NA 1.19E-07 mr1403 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220174255 NA 1.03E-10 mr1435 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220174255 NA 2.01E-10 mr1539 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220174255 NA 3.49E-07 mr1671 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220174255 NA 6.25E-10 mr1089_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220174255 NA 1.11E-07 mr1090_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220174255 NA 1.75E-06 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220174255 NA 1.74E-06 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220174255 NA 2.07E-06 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220174255 NA 5.23E-09 mr1235_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220174255 NA 1.75E-06 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220174255 NA 3.25E-06 mr1262_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220174255 2.91E-15 NA mr1334_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220174255 2.58E-16 2.94E-36 mr1334_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220174255 9.03E-06 9.03E-06 mr1529_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220174255 NA 7.91E-07 mr1671_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220174255 NA 4.49E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220174255 NA 1.37E-07 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220174255 NA 2.54E-07 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220174255 1.25E-11 1.23E-16 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251