RiceVarMap2

Detailed information for vg1220129699:

Variant ID: vg1220129699 (JBrowse)

Variation Type: SNP

Chromosome: chr12

Position: 20129699

Reference Allele: T

Alternative Allele: G

Primary Allele: T

Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGGAAGAGGTGTTGGAAGCGGGACGACGGGATTCGCATCGGATTGATGGAGGTTTTTCTCATCGGACCGGACAACGCCCTGTGGGGAATGTTGCTTTTAC[T/G]
CCTGGGCGAGCTGGTGGGCGAGTTGATGACAGAACTCAGCCTCTGGAGGATCGAGTGGCAGCACTACGTGCTTATCGCAAGGCTAAGGGATTGTGTCACA

Reverse complement sequence

TGTGACACAATCCCTTAGCCTTGCGATAAGCACGTAGTGCTGCCACTCGATCCTCCAGAGGCTGAGTTCTGTCATCAACTCGCCCACCAGCTCGCCCAGG[A/C]
GTAAAAGCAACATTCCCCACAGGGCGTTGTCCGGTCCGATGAGAAAAACCTCCATCAATCCGATGCGAATCCCGTCGTCCCGCTTCCAACACCTCTTCCT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	23.10%	1.70%	7.72%	67.48%	NA
All Indica	2759	4.00%	0.20%	11.09%	84.70%	NA
All Japonica	1512	59.10%	4.90%	0.86%	35.12%	NA
Aus	269	18.20%	0.00%	13.38%	68.40%	NA
Indica I	595	3.00%	0.20%	17.14%	79.66%	NA
Indica II	465	6.90%	0.00%	10.32%	82.80%	NA
Indica III	913	2.80%	0.50%	6.68%	89.92%	NA
Indica Intermediate	786	4.30%	0.00%	12.09%	83.59%	NA
Temperate Japonica	767	92.60%	0.00%	0.78%	6.65%	NA
Tropical Japonica	504	7.90%	14.30%	1.19%	76.59%	NA
Japonica Intermediate	241	59.80%	0.80%	0.41%	39.00%	NA
VI/Aromatic	96	6.20%	0.00%	2.08%	91.67%	NA
Intermediate	90	36.70%	0.00%	8.89%	54.44%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1220129699	T -> DEL	N	N	silent_mutation	Average:22.585; most accessible tissue: Callus, score: 50.714	N	N	N	N
vg1220129699	T -> G	LOC_Os12g33270.1	upstream_gene_variant ; 1393.0bp to feature; MODIFIER	silent_mutation	Average:22.585; most accessible tissue: Callus, score: 50.714	N	N	N	N
vg1220129699	T -> G	LOC_Os12g33289.1	downstream_gene_variant ; 4803.0bp to feature; MODIFIER	silent_mutation	Average:22.585; most accessible tissue: Callus, score: 50.714	N	N	N	N
vg1220129699	T -> G	LOC_Os12g33280.1	intron_variant ; MODIFIER	silent_mutation	Average:22.585; most accessible tissue: Callus, score: 50.714	N	N	N	N

Showing 1 to 4 of 4 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1220129699	4.53E-07	NA	mr1334_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220129699	1.04E-06	NA	mr1991_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 2 of 2 entries

Previous1Next

Contact

Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China

Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/

Search for Variation information by Variation ID:

Detailed information for vg1220129699:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact