\
| Variant ID: vg1220128766 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 20128766 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 68. )
CCATGGCGACAATCCAGAAGCAGAATACCGCCATCCAAGCTTCGATGGGATCCTTGGAGGAAATCAAGCCTATGGTGGTGGAACTCGCGAGCTGGAAGCC[A/G]
GCGGTGGACAAGGCCATGACGGAGATGCGGGACGACCTCGGCGACCTGCGTCAGCAAGTGGAGCGGATATCCCGCAATCCGATTCTCGCCGTCAAGCCAG
CTGGCTTGACGGCGAGAATCGGATTGCGGGATATCCGCTCCACTTGCTGACGCAGGTCGCCGAGGTCGTCCCGCATCTCCGTCATGGCCTTGTCCACCGC[T/C]
GGCTTCCAGCTCGCGAGTTCCACCACCATAGGCTTGATTTCCTCCAAGGATCCCATCGAAGCTTGGATGGCGGTATTCTGCTTCTGGATTGTCGCCATGG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.40% | 13.20% | 38.62% | 8.74% | NA |
| All Indica | 2759 | 27.90% | 19.80% | 46.32% | 5.94% | NA |
| All Japonica | 1512 | 65.50% | 1.70% | 19.05% | 13.76% | NA |
| Aus | 269 | 19.70% | 10.40% | 69.52% | 0.37% | NA |
| Indica I | 595 | 9.60% | 31.30% | 51.93% | 7.23% | NA |
| Indica II | 465 | 38.30% | 10.50% | 42.15% | 9.03% | NA |
| Indica III | 913 | 38.60% | 20.00% | 38.23% | 3.18% | NA |
| Indica Intermediate | 786 | 23.30% | 16.40% | 53.94% | 6.36% | NA |
| Temperate Japonica | 767 | 93.60% | 0.10% | 2.74% | 3.52% | NA |
| Tropical Japonica | 504 | 24.80% | 4.60% | 47.42% | 23.21% | NA |
| Japonica Intermediate | 241 | 61.00% | 0.80% | 11.62% | 26.56% | NA |
| VI/Aromatic | 96 | 8.30% | 14.60% | 39.58% | 37.50% | NA |
| Intermediate | 90 | 46.70% | 11.10% | 37.78% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1220128766 | A -> DEL | LOC_Os12g33280.1 | N | frameshift_variant | Average:27.198; most accessible tissue: Callus, score: 47.912 | N | N | N | N |
| vg1220128766 | A -> G | LOC_Os12g33280.1 | synonymous_variant ; p.Pro44Pro; LOW | synonymous_codon | Average:27.198; most accessible tissue: Callus, score: 47.912 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1220128766 | NA | 6.73E-10 | mr1093 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220128766 | NA | 4.58E-06 | mr1179 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220128766 | 1.55E-21 | NA | mr1334 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220128766 | 1.80E-09 | 1.08E-08 | mr1334 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220128766 | 5.12E-11 | 8.80E-26 | mr1334 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220128766 | NA | 3.43E-09 | mr1403 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220128766 | NA | 1.75E-07 | mr1599 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220128766 | NA | 9.56E-08 | mr1733 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220128766 | 7.68E-06 | 7.68E-06 | mr1987 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220128766 | 1.71E-13 | NA | mr1334_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220128766 | 4.56E-11 | 4.73E-32 | mr1334_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220128766 | 3.90E-06 | NA | mr1991_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220128766 | 5.71E-09 | 3.26E-15 | mr1991_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |