\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220124236:

Variant ID: vg1220124236 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 20124236
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 53. )

Flanking Sequence (100 bp) in Reference Genome:


GGCGTACTAATGGGTATGTTCTCTATCAATTCTACCCCGGTTTCATAATGTAAGTCTATATTCATTAACATCTATATGATTGTAGGCAATGCTAGAATGA[C/T]
TTACATTATGAAACAGAGGAAGTACTTCTATTGCATAACTAAGTTACTTCTGTTGCATGTAATTACTTCTACTACAGAAAGTTACTTCTATTGCATAGCT

Reverse complement sequence

AGCTATGCAATAGAAGTAACTTTCTGTAGTAGAAGTAATTACATGCAACAGAAGTAACTTAGTTATGCAATAGAAGTACTTCCTCTGTTTCATAATGTAA[G/A]
TCATTCTAGCATTGCCTACAATCATATAGATGTTAATGAATATAGACTTACATTATGAAACCGGGGTAGAATTGATAGAGAACATACCCATTAGTACGCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.40% 0.30% 3.53% 56.83% NA
All Indica  2759 25.80% 0.40% 4.31% 69.52% NA
All Japonica  1512 65.30% 0.00% 0.86% 33.86% NA
Aus  269 40.10% 0.00% 10.78% 49.07% NA
Indica I  595 22.00% 0.70% 4.20% 73.11% NA
Indica II  465 23.00% 0.40% 5.38% 71.18% NA
Indica III  913 33.10% 0.00% 4.38% 62.54% NA
Indica Intermediate  786 21.80% 0.60% 3.69% 73.92% NA
Temperate Japonica  767 93.60% 0.00% 0.26% 6.13% NA
Tropical Japonica  504 24.00% 0.00% 1.98% 74.01% NA
Japonica Intermediate  241 61.40% 0.00% 0.41% 38.17% NA
VI/Aromatic  96 14.60% 0.00% 5.21% 80.21% NA
Intermediate  90 45.60% 1.10% 1.11% 52.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1220124236 C -> DEL N N silent_mutation Average:15.771; most accessible tissue: Callus, score: 28.085 N N N N
vg1220124236 C -> T LOC_Os12g33280.1 upstream_gene_variant ; 4163.0bp to feature; MODIFIER silent_mutation Average:15.771; most accessible tissue: Callus, score: 28.085 N N N N
vg1220124236 C -> T LOC_Os12g33260.1 downstream_gene_variant ; 53.0bp to feature; MODIFIER silent_mutation Average:15.771; most accessible tissue: Callus, score: 28.085 N N N N
vg1220124236 C -> T LOC_Os12g33270.1 downstream_gene_variant ; 1028.0bp to feature; MODIFIER silent_mutation Average:15.771; most accessible tissue: Callus, score: 28.085 N N N N
vg1220124236 C -> T LOC_Os12g33260-LOC_Os12g33270 intergenic_region ; MODIFIER silent_mutation Average:15.771; most accessible tissue: Callus, score: 28.085 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1220124236 NA 1.42E-07 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220124236 NA 6.78E-13 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220124236 NA 1.52E-06 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220124236 NA 1.20E-06 mr1034 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220124236 NA 3.70E-13 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220124236 NA 3.86E-06 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220124236 NA 1.67E-43 mr1089 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220124236 NA 6.73E-44 mr1093 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220124236 NA 1.58E-10 mr1093 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220124236 NA 7.50E-06 mr1125 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220124236 NA 1.62E-39 mr1235 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220124236 NA 1.10E-09 mr1251 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220124236 NA 1.28E-06 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220124236 8.95E-41 1.64E-151 mr1334 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220124236 3.92E-17 3.33E-33 mr1334 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220124236 NA 2.49E-37 mr1435 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220124236 NA 1.09E-10 mr1539 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220124236 NA 2.70E-36 mr1784 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220124236 NA 1.27E-09 mr1790 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220124236 NA 9.69E-09 mr1864 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220124236 NA 3.60E-10 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220124236 NA 1.98E-50 mr1089_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220124236 NA 1.24E-20 mr1308_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220124236 1.39E-53 1.41E-182 mr1334_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220124236 1.93E-19 1.78E-42 mr1334_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220124236 NA 7.89E-08 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220124236 NA 2.67E-11 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220124236 4.74E-22 7.07E-78 mr1991_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220124236 6.65E-13 3.63E-18 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251