Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220124236:

Variant ID: vg1220124236 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 20124236
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 53. )

Flanking Sequence (100 bp) in Reference Genome:

GGCGTACTAATGGGTATGTTCTCTATCAATTCTACCCCGGTTTCATAATGTAAGTCTATATTCATTAACATCTATATGATTGTAGGCAATGCTAGAATGA[C/T]
TTACATTATGAAACAGAGGAAGTACTTCTATTGCATAACTAAGTTACTTCTGTTGCATGTAATTACTTCTACTACAGAAAGTTACTTCTATTGCATAGCT

Reverse complement sequence

AGCTATGCAATAGAAGTAACTTTCTGTAGTAGAAGTAATTACATGCAACAGAAGTAACTTAGTTATGCAATAGAAGTACTTCCTCTGTTTCATAATGTAA[G/A]
TCATTCTAGCATTGCCTACAATCATATAGATGTTAATGAATATAGACTTACATTATGAAACCGGGGTAGAATTGATAGAGAACATACCCATTAGTACGCC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.40%	0.30%	3.53%	56.83%	NA
All Indica	2759	25.80%	0.40%	4.31%	69.52%	NA
All Japonica	1512	65.30%	0.00%	0.86%	33.86%	NA
Aus	269	40.10%	0.00%	10.78%	49.07%	NA
Indica I	595	22.00%	0.70%	4.20%	73.11%	NA
Indica II	465	23.00%	0.40%	5.38%	71.18%	NA
Indica III	913	33.10%	0.00%	4.38%	62.54%	NA
Indica Intermediate	786	21.80%	0.60%	3.69%	73.92%	NA
Temperate Japonica	767	93.60%	0.00%	0.26%	6.13%	NA
Tropical Japonica	504	24.00%	0.00%	1.98%	74.01%	NA
Japonica Intermediate	241	61.40%	0.00%	0.41%	38.17%	NA
VI/Aromatic	96	14.60%	0.00%	5.21%	80.21%	NA
Intermediate	90	45.60%	1.10%	1.11%	52.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1220124236	C -> DEL	N	N	silent_mutation	Average:15.771; most accessible tissue: Callus, score: 28.085	N	N	N	N
vg1220124236	C -> T	LOC_Os12g33280.1	upstream_gene_variant ; 4163.0bp to feature; MODIFIER	silent_mutation	Average:15.771; most accessible tissue: Callus, score: 28.085	N	N	N	N
vg1220124236	C -> T	LOC_Os12g33260.1	downstream_gene_variant ; 53.0bp to feature; MODIFIER	silent_mutation	Average:15.771; most accessible tissue: Callus, score: 28.085	N	N	N	N
vg1220124236	C -> T	LOC_Os12g33270.1	downstream_gene_variant ; 1028.0bp to feature; MODIFIER	silent_mutation	Average:15.771; most accessible tissue: Callus, score: 28.085	N	N	N	N
vg1220124236	C -> T	LOC_Os12g33260-LOC_Os12g33270	intergenic_region ; MODIFIER	silent_mutation	Average:15.771; most accessible tissue: Callus, score: 28.085	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1220124236	NA	1.42E-07	mr1013	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220124236	NA	6.78E-13	mr1031	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220124236	NA	1.52E-06	mr1031	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220124236	NA	1.20E-06	mr1034	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220124236	NA	3.70E-13	mr1056	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220124236	NA	3.86E-06	mr1056	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220124236	NA	1.67E-43	mr1089	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220124236	NA	6.73E-44	mr1093	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220124236	NA	1.58E-10	mr1093	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220124236	NA	7.50E-06	mr1125	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220124236	NA	1.62E-39	mr1235	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220124236	NA	1.10E-09	mr1251	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220124236	NA	1.28E-06	mr1252	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220124236	8.95E-41	1.64E-151	mr1334	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220124236	3.92E-17	3.33E-33	mr1334	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220124236	NA	2.49E-37	mr1435	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220124236	NA	1.09E-10	mr1539	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220124236	NA	2.70E-36	mr1784	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220124236	NA	1.27E-09	mr1790	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220124236	NA	9.69E-09	mr1864	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220124236	NA	3.60E-10	mr1011_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220124236	NA	1.98E-50	mr1089_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220124236	NA	1.24E-20	mr1308_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220124236	1.39E-53	1.41E-182	mr1334_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220124236	1.93E-19	1.78E-42	mr1334_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220124236	NA	7.89E-08	mr1817_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220124236	NA	2.67E-11	mr1830_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220124236	4.74E-22	7.07E-78	mr1991_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220124236	6.65E-13	3.63E-18	mr1991_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251