Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220059260:

Variant ID: vg1220059260 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 20059260
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGAGGAAATGTTCCAAGAGGTTAGACCTCTTGCTAACTTTCCTCCAAAATGTGCATAGGATTACCCATTCCTTAGGAATTTTGAAGGATTGGATAGGATT[C/T]
AATCCTTTATTTCAAAGGCCTTCATAGGATTTTTTTCCATAGGATTGAAATCCACCAAAATTCCTACATTTTTTTCTACAAATCAAAGGGGCCCTTATAA

Reverse complement sequence

TTATAAGGGCCCCTTTGATTTGTAGAAAAAAATGTAGGAATTTTGGTGGATTTCAATCCTATGGAAAAAAATCCTATGAAGGCCTTTGAAATAAAGGATT[G/A]
AATCCTATCCAATCCTTCAAAATTCCTAAGGAATGGGTAATCCTATGCACATTTTGGAGGAAAGTTAGCAAGAGGTCTAACCTCTTGGAACATTTCCTCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.60% 0.60% 2.31% 50.51% NA
All Indica  2759 40.30% 0.00% 2.61% 57.12% NA
All Japonica  1512 58.80% 1.80% 1.72% 37.70% NA
Aus  269 52.40% 0.00% 2.23% 45.35% NA
Indica I  595 41.20% 0.00% 1.68% 57.14% NA
Indica II  465 58.50% 0.00% 1.51% 40.00% NA
Indica III  913 25.60% 0.00% 3.50% 70.87% NA
Indica Intermediate  786 45.80% 0.00% 2.93% 51.27% NA
Temperate Japonica  767 84.70% 2.70% 2.22% 10.30% NA
Tropical Japonica  504 24.60% 0.20% 1.19% 74.01% NA
Japonica Intermediate  241 47.70% 2.10% 1.24% 48.96% NA
VI/Aromatic  96 11.50% 0.00% 2.08% 86.46% NA
Intermediate  90 56.70% 0.00% 3.33% 40.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1220059260 C -> DEL N N silent_mutation Average:40.704; most accessible tissue: Callus, score: 58.942 N N N N
vg1220059260 C -> T LOC_Os12g33160.1 downstream_gene_variant ; 2304.0bp to feature; MODIFIER silent_mutation Average:40.704; most accessible tissue: Callus, score: 58.942 N N N N
vg1220059260 C -> T LOC_Os12g33150.1 intron_variant ; MODIFIER silent_mutation Average:40.704; most accessible tissue: Callus, score: 58.942 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1220059260 3.62E-08 3.62E-08 mr1008 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220059260 5.50E-08 5.50E-08 mr1009 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220059260 3.54E-07 3.54E-07 mr1065 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220059260 1.85E-08 1.85E-08 mr1067 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220059260 2.05E-06 NA mr1124 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220059260 NA 9.44E-06 mr1152 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220059260 8.65E-07 8.65E-07 mr1200 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220059260 9.09E-09 9.09E-09 mr1750 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220059260 4.76E-06 NA mr1771 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220059260 1.30E-07 1.30E-07 mr1855 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251