\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220035763:

Variant ID: vg1220035763 (JBrowse)Variation Type: INDEL
Chromosome: chr12Position: 20035763
Reference Allele: TAlternative Allele: TCC,C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAGATTTTTAGTCCCGGTTATTTTACCCAGGACTAAAGATGGGTATCTTTAGTCCCGGATTCGTAGTCCCGGTTGTATAACCGGGACTATAGGGGGGTTT[T/TCC,C]
CAACCGGGAGTAAAGCCCCTTTCTTCATCAGTGAATAATATATAAGCACCGTAGAAGTGTTGGTCCATTGGAATTTCTTTGAACTTTGAGGGAATAAATG

Reverse complement sequence

CATTTATTCCCTCAAAGTTCAAAGAAATTCCAATGGACCAACACTTCTACGGTGCTTATATATTATTCACTGATGAAGAAAGGGGCTTTACTCCCGGTTG[A/GGA,G]
AAACCCCCCTATAGTCCCGGTTATACAACCGGGACTACGAATCCGGGACTAAAGATACCCATCTTTAGTCCTGGGTAAAATAACCGGGACTAAAAATCTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.60% 29.40% 12.23% 5.56% TCC: 13.25%
All Indica  2759 26.90% 26.90% 16.49% 9.31% TCC: 20.41%
All Japonica  1512 64.90% 34.20% 0.46% 0.20% TCC: 0.20%
Aus  269 37.20% 8.60% 34.94% 0.00% TCC: 19.33%
Indica I  595 6.10% 58.00% 15.29% 8.40% TCC: 12.27%
Indica II  465 28.80% 4.10% 24.52% 16.99% TCC: 25.59%
Indica III  913 42.80% 22.60% 11.17% 5.04% TCC: 18.40%
Indica Intermediate  786 23.00% 21.90% 18.83% 10.43% TCC: 25.83%
Temperate Japonica  767 93.00% 6.00% 0.52% 0.26% TCC: 0.26%
Tropical Japonica  504 24.60% 75.00% 0.20% 0.00% TCC: 0.20%
Japonica Intermediate  241 60.20% 38.60% 0.83% 0.41% NA
VI/Aromatic  96 6.20% 80.20% 11.46% 1.04% TCC: 1.04%
Intermediate  90 44.40% 33.30% 12.22% 2.22% TCC: 7.78%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1220035763 T -> C LOC_Os12g33100.1 upstream_gene_variant ; 2892.0bp to feature; MODIFIER silent_mutation Average:85.199; most accessible tissue: Minghui63 young leaf, score: 96.22 N N N N
vg1220035763 T -> C LOC_Os12g33110.1 downstream_gene_variant ; 4311.0bp to feature; MODIFIER silent_mutation Average:85.199; most accessible tissue: Minghui63 young leaf, score: 96.22 N N N N
vg1220035763 T -> C LOC_Os12g33100-LOC_Os12g33110 intergenic_region ; MODIFIER silent_mutation Average:85.199; most accessible tissue: Minghui63 young leaf, score: 96.22 N N N N
vg1220035763 T -> DEL N N silent_mutation Average:85.199; most accessible tissue: Minghui63 young leaf, score: 96.22 N N N N
vg1220035763 T -> TCC LOC_Os12g33100.1 upstream_gene_variant ; 2893.0bp to feature; MODIFIER silent_mutation Average:85.199; most accessible tissue: Minghui63 young leaf, score: 96.22 N N N N
vg1220035763 T -> TCC LOC_Os12g33110.1 downstream_gene_variant ; 4310.0bp to feature; MODIFIER silent_mutation Average:85.199; most accessible tissue: Minghui63 young leaf, score: 96.22 N N N N
vg1220035763 T -> TCC LOC_Os12g33100-LOC_Os12g33110 intergenic_region ; MODIFIER silent_mutation Average:85.199; most accessible tissue: Minghui63 young leaf, score: 96.22 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1220035763 T C 0.02 -0.01 -0.05 0.02 0.02 0.02
vg1220035763 T TCC -0.01 -0.31 -0.38 0.03 0.0 0.15

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1220035763 NA 1.95E-07 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220035763 NA 7.52E-07 mr1034 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220035763 NA 1.56E-10 mr1093 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220035763 NA 7.11E-06 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220035763 NA 1.08E-06 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220035763 1.48E-18 NA mr1334 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220035763 2.90E-17 6.89E-33 mr1334 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220035763 2.00E-06 2.00E-06 mr1360 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220035763 NA 1.59E-07 mr1403 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220035763 NA 1.75E-07 mr1599 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220035763 NA 6.09E-07 mr1671 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220035763 NA 7.21E-08 mr1864 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220035763 NA 3.30E-09 mr1235_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220035763 NA 4.40E-06 mr1268_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220035763 1.44E-15 NA mr1334_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220035763 1.18E-19 8.16E-42 mr1334_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220035763 NA 2.14E-07 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220035763 1.15E-06 NA mr1991_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220035763 2.93E-13 2.04E-18 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251