\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219966213:

Variant ID: vg1219966213 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 19966213
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.78, A: 0.21, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:


TGAGTTTTAATTATTACAAACTTAGAAAATAGATTAATCTGATATTTTAGAGCAACTTTCATATAGAAAGTTTTTTATGAAACATACAGTTTAGCAGTTT[A/G]
AAAAGCGTGCCACAAATATCCAAAATTTCATCCACTTCTTGCAGTGGAAACGAACAGGATTTTCCTTGGAAAAAATACTACTAGCATTACCTAGTTGGGG

Reverse complement sequence

CCCCAACTAGGTAATGCTAGTAGTATTTTTTCCAAGGAAAATCCTGTTCGTTTCCACTGCAAGAAGTGGATGAAATTTTGGATATTTGTGGCACGCTTTT[T/C]
AAACTGCTAAACTGTATGTTTCATAAAAAACTTTCTATATGAAAGTTGCTCTAAAATATCAGATTAATCTATTTTCTAAGTTTGTAATAATTAAAACTCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.50% 40.30% 3.17% 0.00% NA
All Indica  2759 89.80% 8.00% 2.21% 0.00% NA
All Japonica  1512 3.20% 96.70% 0.13% 0.00% NA
Aus  269 39.80% 31.60% 28.62% 0.00% NA
Indica I  595 89.40% 10.10% 0.50% 0.00% NA
Indica II  465 94.40% 4.50% 1.08% 0.00% NA
Indica III  913 90.00% 7.20% 2.74% 0.00% NA
Indica Intermediate  786 87.20% 9.30% 3.56% 0.00% NA
Temperate Japonica  767 1.60% 98.20% 0.26% 0.00% NA
Tropical Japonica  504 5.00% 95.00% 0.00% 0.00% NA
Japonica Intermediate  241 4.60% 95.40% 0.00% 0.00% NA
VI/Aromatic  96 7.30% 84.40% 8.33% 0.00% NA
Intermediate  90 35.60% 62.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1219966213 A -> G LOC_Os12g33050.1 upstream_gene_variant ; 2146.0bp to feature; MODIFIER silent_mutation Average:72.277; most accessible tissue: Zhenshan97 flower, score: 87.04 N N N N
vg1219966213 A -> G LOC_Os12g33040-LOC_Os12g33050 intergenic_region ; MODIFIER silent_mutation Average:72.277; most accessible tissue: Zhenshan97 flower, score: 87.04 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1219966213 NA 1.55E-26 mr1024 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219966213 4.77E-08 NA mr1334 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219966213 NA 2.15E-14 mr1376 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219966213 NA 2.15E-14 mr1431 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219966213 NA 2.17E-22 mr1698 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219966213 NA 8.79E-37 mr1719 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219966213 NA 2.78E-27 mr1024_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219966213 NA 3.09E-09 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219966213 NA 9.75E-15 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219966213 NA 4.94E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219966213 NA 6.54E-09 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219966213 NA 1.36E-06 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219966213 NA 2.67E-18 mr1239_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219966213 NA 2.12E-06 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219966213 NA 4.93E-22 mr1298_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219966213 6.14E-11 NA mr1334_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219966213 NA 3.10E-07 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219966213 2.35E-06 1.17E-18 mr1383_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219966213 NA 1.60E-07 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219966213 NA 7.30E-15 mr1529_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219966213 NA 3.41E-15 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219966213 NA 8.76E-10 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219966213 NA 1.06E-07 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219966213 NA 1.02E-23 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219966213 NA 3.68E-21 mr1731_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219966213 NA 1.98E-32 mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219966213 NA 1.84E-22 mr1922_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219966213 NA 2.29E-09 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219966213 NA 2.26E-42 mr1944_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251