Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219966196:

Variant ID: vg1219966196 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 19966196
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.69, G: 0.31, others allele: 0.00, population size: 62. )

Flanking Sequence (100 bp) in Reference Genome:

AATAACGTGTGATTAATTGAGTTTTAATTATTACAAACTTAGAAAATAGATTAATCTGATATTTTAGAGCAACTTTCATATAGAAAGTTTTTTATGAAAC[A/G]
TACAGTTTAGCAGTTTAAAAAGCGTGCCACAAATATCCAAAATTTCATCCACTTCTTGCAGTGGAAACGAACAGGATTTTCCTTGGAAAAAATACTACTA

Reverse complement sequence

TAGTAGTATTTTTTCCAAGGAAAATCCTGTTCGTTTCCACTGCAAGAAGTGGATGAAATTTTGGATATTTGTGGCACGCTTTTTAAACTGCTAAACTGTA[T/C]
GTTTCATAAAAAACTTTCTATATGAAAGTTGCTCTAAAATATCAGATTAATCTATTTTCTAAGTTTGTAATAATTAAAACTCAATTAATCACACGTTATT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.10%	37.70%	3.17%	0.00%	NA
All Indica	2759	93.90%	3.90%	2.21%	0.00%	NA
All Japonica	1512	3.50%	96.40%	0.13%	0.00%	NA
Aus	269	43.10%	30.50%	26.39%	0.00%	NA
Indica I	595	96.00%	3.00%	1.01%	0.00%	NA
Indica II	465	95.10%	4.30%	0.65%	0.00%	NA
Indica III	913	94.90%	2.00%	3.18%	0.00%	NA
Indica Intermediate	786	90.60%	6.50%	2.93%	0.00%	NA
Temperate Japonica	767	1.80%	97.90%	0.26%	0.00%	NA
Tropical Japonica	504	5.40%	94.60%	0.00%	0.00%	NA
Japonica Intermediate	241	5.00%	95.00%	0.00%	0.00%	NA
VI/Aromatic	96	2.10%	84.40%	13.54%	0.00%	NA
Intermediate	90	35.60%	61.10%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1219966196	A -> G	LOC_Os12g33050.1	upstream_gene_variant ; 2163.0bp to feature; MODIFIER	silent_mutation	Average:78.314; most accessible tissue: Zhenshan97 flower, score: 90.51	N	N	N	N
vg1219966196	A -> G	LOC_Os12g33040-LOC_Os12g33050	intergenic_region ; MODIFIER	silent_mutation	Average:78.314; most accessible tissue: Zhenshan97 flower, score: 90.51	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1219966196	4.03E-09	NA	mr1334	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219966196	1.23E-08	6.56E-11	mr1334	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219966196	NA	5.80E-21	mr1698	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219966196	NA	5.63E-27	mr1024_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219966196	NA	3.05E-09	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219966196	NA	1.21E-15	mr1133_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219966196	NA	9.71E-09	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219966196	NA	3.91E-09	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219966196	NA	1.56E-06	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219966196	NA	1.09E-06	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219966196	NA	7.56E-22	mr1298_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219966196	NA	3.74E-22	mr1304_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219966196	7.99E-09	NA	mr1334_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219966196	3.50E-07	1.82E-09	mr1334_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219966196	NA	2.21E-15	mr1529_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219966196	NA	5.02E-15	mr1575_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219966196	NA	6.45E-10	mr1646_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219966196	NA	5.87E-11	mr1667_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219966196	NA	6.72E-08	mr1681_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219966196	NA	3.29E-23	mr1698_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219966196	NA	5.11E-21	mr1731_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219966196	NA	1.07E-14	mr1767_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219966196	NA	3.67E-11	mr1830_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219966196	NA	1.72E-32	mr1873_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219966196	NA	1.19E-07	mr1909_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219966196	NA	1.98E-07	mr1921_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219966196	NA	1.16E-21	mr1922_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219966196	NA	5.42E-09	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251