\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219955678:

Variant ID: vg1219955678 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 19955678
Reference Allele: CAlternative Allele: T,A
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.79, T: 0.21, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:


CTACCGGAGTCCCATTTGGGACTGCCCCTGATGGCACCGTGGTGGAATGCCCTTCCGTCGGACCCGCTGTGGAATTCCTCGTTCGTGGGTGCGCAATCGT[C/T,A]
GGCCTCAAAGCCACTTCTTTTTAGTACTCATAAAAGGAGAGAAAACCTGAAAAGTAGAATGCAAGTTCTTGCGCCAAATTCATCTGTGTGCTCTTCGTTC

Reverse complement sequence

GAACGAAGAGCACACAGATGAATTTGGCGCAAGAACTTGCATTCTACTTTTCAGGTTTTCTCTCCTTTTATGAGTACTAAAAAGAAGTGGCTTTGAGGCC[G/A,T]
ACGATTGCGCACCCACGAACGAGGAATTCCACAGCGGGTCCGACGGAAGGGCATTCCACCACGGTGCCATCAGGGGCAGTCCCAAATGGGACTCCGGTAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.70% 41.00% 0.30% 0.00% NA
All Indica  2759 93.70% 5.80% 0.51% 0.00% NA
All Japonica  1512 3.80% 96.20% 0.00% 0.00% NA
Aus  269 38.70% 61.30% 0.00% 0.00% NA
Indica I  595 96.80% 2.20% 1.01% 0.00% NA
Indica II  465 94.80% 5.20% 0.00% 0.00% NA
Indica III  913 94.00% 5.50% 0.55% 0.00% NA
Indica Intermediate  786 90.30% 9.30% 0.38% 0.00% NA
Temperate Japonica  767 2.00% 98.00% 0.00% 0.00% NA
Tropical Japonica  504 5.40% 94.60% 0.00% 0.00% NA
Japonica Intermediate  241 6.20% 93.80% 0.00% 0.00% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 30.00% 70.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1219955678 C -> A LOC_Os12g33030.1 upstream_gene_variant ; 476.0bp to feature; MODIFIER N Average:61.169; most accessible tissue: Callus, score: 77.696 N N N N
vg1219955678 C -> A LOC_Os12g33040.1 upstream_gene_variant ; 3186.0bp to feature; MODIFIER N Average:61.169; most accessible tissue: Callus, score: 77.696 N N N N
vg1219955678 C -> A LOC_Os12g33020.1 downstream_gene_variant ; 2460.0bp to feature; MODIFIER N Average:61.169; most accessible tissue: Callus, score: 77.696 N N N N
vg1219955678 C -> A LOC_Os12g33030-LOC_Os12g33040 intergenic_region ; MODIFIER N Average:61.169; most accessible tissue: Callus, score: 77.696 N N N N
vg1219955678 C -> T LOC_Os12g33030.1 upstream_gene_variant ; 476.0bp to feature; MODIFIER silent_mutation Average:61.169; most accessible tissue: Callus, score: 77.696 N N N N
vg1219955678 C -> T LOC_Os12g33040.1 upstream_gene_variant ; 3186.0bp to feature; MODIFIER silent_mutation Average:61.169; most accessible tissue: Callus, score: 77.696 N N N N
vg1219955678 C -> T LOC_Os12g33020.1 downstream_gene_variant ; 2460.0bp to feature; MODIFIER silent_mutation Average:61.169; most accessible tissue: Callus, score: 77.696 N N N N
vg1219955678 C -> T LOC_Os12g33030-LOC_Os12g33040 intergenic_region ; MODIFIER silent_mutation Average:61.169; most accessible tissue: Callus, score: 77.696 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1219955678 NA 1.09E-08 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219955678 NA 8.31E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219955678 1.13E-06 NA mr1334 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219955678 2.18E-06 2.27E-09 mr1334 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219955678 NA 9.90E-06 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219955678 NA 1.44E-25 mr1024_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219955678 NA 6.53E-09 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219955678 NA 6.06E-09 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219955678 5.50E-10 NA mr1334_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219955678 1.70E-11 1.47E-14 mr1334_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219955678 NA 6.76E-24 mr1350_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219955678 NA 2.32E-06 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219955678 NA 1.13E-09 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219955678 NA 3.15E-14 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219955678 NA 8.55E-10 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219955678 NA 1.02E-22 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219955678 NA 8.99E-09 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219955678 NA 1.87E-20 mr1922_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219955678 NA 7.31E-21 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219955678 NA 4.05E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219955678 NA 9.29E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251