Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219955678:

Variant ID: vg1219955678 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 19955678
Reference Allele: C	Alternative Allele: T,A
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.79, T: 0.21, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:

CTACCGGAGTCCCATTTGGGACTGCCCCTGATGGCACCGTGGTGGAATGCCCTTCCGTCGGACCCGCTGTGGAATTCCTCGTTCGTGGGTGCGCAATCGT[C/T,A]
GGCCTCAAAGCCACTTCTTTTTAGTACTCATAAAAGGAGAGAAAACCTGAAAAGTAGAATGCAAGTTCTTGCGCCAAATTCATCTGTGTGCTCTTCGTTC

Reverse complement sequence

GAACGAAGAGCACACAGATGAATTTGGCGCAAGAACTTGCATTCTACTTTTCAGGTTTTCTCTCCTTTTATGAGTACTAAAAAGAAGTGGCTTTGAGGCC[G/A,T]
ACGATTGCGCACCCACGAACGAGGAATTCCACAGCGGGTCCGACGGAAGGGCATTCCACCACGGTGCCATCAGGGGCAGTCCCAAATGGGACTCCGGTAG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.70%	41.00%	0.30%	0.00%	NA
All Indica	2759	93.70%	5.80%	0.51%	0.00%	NA
All Japonica	1512	3.80%	96.20%	0.00%	0.00%	NA
Aus	269	38.70%	61.30%	0.00%	0.00%	NA
Indica I	595	96.80%	2.20%	1.01%	0.00%	NA
Indica II	465	94.80%	5.20%	0.00%	0.00%	NA
Indica III	913	94.00%	5.50%	0.55%	0.00%	NA
Indica Intermediate	786	90.30%	9.30%	0.38%	0.00%	NA
Temperate Japonica	767	2.00%	98.00%	0.00%	0.00%	NA
Tropical Japonica	504	5.40%	94.60%	0.00%	0.00%	NA
Japonica Intermediate	241	6.20%	93.80%	0.00%	0.00%	NA
VI/Aromatic	96	3.10%	96.90%	0.00%	0.00%	NA
Intermediate	90	30.00%	70.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1219955678	C -> A	LOC_Os12g33030.1	upstream_gene_variant ; 476.0bp to feature; MODIFIER	N	Average:61.169; most accessible tissue: Callus, score: 77.696	N	N	N	N
vg1219955678	C -> A	LOC_Os12g33040.1	upstream_gene_variant ; 3186.0bp to feature; MODIFIER	N	Average:61.169; most accessible tissue: Callus, score: 77.696	N	N	N	N
vg1219955678	C -> A	LOC_Os12g33020.1	downstream_gene_variant ; 2460.0bp to feature; MODIFIER	N	Average:61.169; most accessible tissue: Callus, score: 77.696	N	N	N	N
vg1219955678	C -> A	LOC_Os12g33030-LOC_Os12g33040	intergenic_region ; MODIFIER	N	Average:61.169; most accessible tissue: Callus, score: 77.696	N	N	N	N
vg1219955678	C -> T	LOC_Os12g33030.1	upstream_gene_variant ; 476.0bp to feature; MODIFIER	silent_mutation	Average:61.169; most accessible tissue: Callus, score: 77.696	N	N	N	N
vg1219955678	C -> T	LOC_Os12g33040.1	upstream_gene_variant ; 3186.0bp to feature; MODIFIER	silent_mutation	Average:61.169; most accessible tissue: Callus, score: 77.696	N	N	N	N
vg1219955678	C -> T	LOC_Os12g33020.1	downstream_gene_variant ; 2460.0bp to feature; MODIFIER	silent_mutation	Average:61.169; most accessible tissue: Callus, score: 77.696	N	N	N	N
vg1219955678	C -> T	LOC_Os12g33030-LOC_Os12g33040	intergenic_region ; MODIFIER	silent_mutation	Average:61.169; most accessible tissue: Callus, score: 77.696	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1219955678	NA	1.09E-08	mr1047	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219955678	NA	8.31E-06	mr1189	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219955678	1.13E-06	NA	mr1334	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219955678	2.18E-06	2.27E-09	mr1334	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219955678	NA	9.90E-06	mr1625	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219955678	NA	1.44E-25	mr1024_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219955678	NA	6.53E-09	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219955678	NA	6.06E-09	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219955678	5.50E-10	NA	mr1334_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219955678	1.70E-11	1.47E-14	mr1334_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219955678	NA	6.76E-24	mr1350_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219955678	NA	2.32E-06	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219955678	NA	1.13E-09	mr1506_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219955678	NA	3.15E-14	mr1575_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219955678	NA	8.55E-10	mr1646_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219955678	NA	1.02E-22	mr1698_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219955678	NA	8.99E-09	mr1751_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219955678	NA	1.87E-20	mr1922_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219955678	NA	7.31E-21	mr1924_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219955678	NA	4.05E-08	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219955678	NA	9.29E-06	mr1992_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251